Задержка из за нервов: Задержка месячных из-за стресса: что делать, как восстановить, симптомы

Содержание

Задержка месячных из-за стресса: что делать, как восстановить, симптомы

Задержка месячных из-за стресса – это распространенная проблема, которая хотя бы раз в жизни беспокоила каждую женщину. Стандартный менструальный цикл составляет 28 дней с небольшими индивидуальными отклонениями, но стрессовые факторы могут повлиять на продолжительность и вызвать отклонения в графике месячных.

Могут ли месячные пропасть из-за стресса

Психосоматические заболевания встречаются не так редко, как кажется. Ежедневные хронические стрессы, воздействие факторов физического и эмоционального характера через вполне реальные физиологические механизмы отражаются на работе систем органов.

Для женщины правильный менструальный цикл – это важный показатель здоровья. Также для женского пола в силу воспитания, социальных и эволюционных причин характерны смены психического состояния, перепады эмоционального настроения. Все это в комбинации повышает риск задержки месячных после стресса.

Основной симптом после стресса – это увеличение временных границ менструального цикла. Это значит, что месячные могут либо раньше начаться, либо появиться с задержкой. Продолжительность стресса, как и его интенсивность, прямо пропорционально влияют на сроки смещения «этих дней».

Кроме этого, женщины жалуются на общесоматические симптомы:

  • бессонница,
  • головные боли,
  • температура,
  • повышение артериального давления,
  • быстрая утомляемость и низкая работоспособность,
  • смещение психоэмоционального состояния, истерия,
  • депрессивные настроения.

Механизм влияния стресса

Отсутствие месячных из-за стресса связано с механизмами работы нейро-гуморальной регуляции организма женщины. С точки зрения физиологии, работа половых органов зависит от:

  1. Работы вегетативной нервной системы.
  2. Работы эндокринных желез.

Роль нервной системы в смещении менструального цикла

Матка – это орган с мощной мышечной стенкой и обильным кровоснабжением. Ткани матки иннервируются сотнями нервных волокон, которые регулируют способность мышц к сокращению, а также сужение и расширение кровеносных сосудов, капилляров.

Поэтому нарушение работы вегетативной системы приводит к раннему появлению месячных из-за отслойки эндометрия в силу невозможности «удержать» его. Так, цикл становится меньше и составляет 24-26 дней, что может сильно обеспокоить женщину. Раннее появление крови, как и задержка месячных, может насторожить, так как, есть риск наличия кровотечений, серьезных нарушений структуры органов.

Важно! Физические нагрузки – частая причина раннего появления месячных.

Физическое напряжение в совокупности с нервными расстройствами приводит к уменьшению менструального цикла, поэтому напряжение на работе, посещения спортзала, дачные работы или просто повышенные физические нагрузки в течение дня – все это может стать причиной патологии.

Это не значит, что теперь нужно ограничивать себя в физическом развитии, но дозирование нагрузок уместно в любом ремесле и занятии.

Влияние пролактина

Из-за стресса может быть задержка месячных, связанная с некорректной работой эндокринной системой. Главенствующее положение в регуляции биоритмов занимают половые гормоны, а именно пролактин, прогестерон, эстрогены.

Возникновение нервных импульсов, возникающих во время стресса, стимулируют вырабатывание пролактина клетками гипофиза. Гипофиз – это железа внутренней секреции, которая регулирует большинство органов эндокринной системы. Нарушение работы гипофиза приводит к стойкому дисбалансу половых органов в организме женщины и, как следствие, к задержке месячных.

Физиологическое увеличение концентрации пролактина наблюдается в период беременности, когда вместе с прогестероном оба гормона тормозят появление месячных, способствуют прикреплению плода к стенке матки, а в период лактации помогают стимулировать синтез молока.

Под влиянием стрессов молочные железы остаются неактивными, но наблюдается стойкая задержка месячных. Менструальный цикл увеличивается до 32-35 дней, а продолжается это от месяца до нескольких лет.

Важно! Продолжительная аменорея (отсутствие месячных) является одним из показаний к медикаментозному лечению.

Влияние кортизола

Кортизол – это гормон, вырабатываемый корой надпочечников. Надпочечники принимают активное участие в реагировании на стресс и развитии компенсаторных реакций. При длительном или сильном воздействии стрессового фактора структура органа изменяется, он увеличивается в размере. Из-за этого количество синтезируемого кортизола также возрастает.

Патологическое действие кортизола связано с ожирением. Организм начинает страдать от хронического избытка липидов, что отражается на всех системах органов. Конкретно гипофиз отвечает избыточным выделением эстрогенов, что повышает их концентрацию в крови.

Из-за этого наблюдаются следующие патологические процессы:

  1. Резкие изменения менструального цикла: задержка или раннее наступление месячных.
  2. Появление вторичных мужских признаков: огрубение голоса, увеличение волосяного покрова (в том числе на лице).
  3. Ухудшение состояния кожи.
  4. Структурные патологические изменения яичников.

Важно! Ожирение, избыток эстрогенов – это факторы риска поликистоза яичников.

Что делать, если нет месячных из-за стресса

Симптомы задержки месячных возникают на нервной почве, и это ключ к борьбе с проблемами измененного менструального цикла. Вот несколько рекомендаций, которые помогут справиться с проблемой.

Не паниковать

Задержка месячных из-за нервов, так же как и их обильное выделение до назначенного срока, сильно пугают женщину. Причинами сбоя могут быть беременность, кровотечения, структурные изменения половых органов.

Эмоциональный и физический стресс – это еще одна весомая причина задержки месячных, причем из всего списка самая безобидная и легко устранимая. Наряду с этим стресс поджидает на каждом шагу в течение всего дня, поэтому вероятность воздействия именного этого фактора выше всего.

Важно! Если же женщина подозревает в качестве источника задержки месячных возможную беременность или кровотечение, необходимо обратиться к гинекологу.

Найти и устранить стрессовый фактор

Список причин, которые попадают под категорию «стресс», обширен:

  • проблемы на работе,
  • проблемы с личной жизнью,
  • проблемы со своим здоровьем и здоровьем родных,
  • сильные положительные эмоции,
  • диеты,
  • переезды, туристические поездки в страны с другим климатом,
  • тяжелая физическая нагрузка.

Не всегда получается избавиться от стресса, но можно помочь своему организму бороться с ним. Этому помогут следующие советы:

  1. Войти в зону комфорта, занявшись любимым делом или сделав себе приятное (шопинг, отгул, теплая ванна, десерт на ужин).
  2. Обеспечить продолжительный и качественный сон.
  3. Следить за питанием: никаких изнуряющих диет, только полноценная, богатая питательными веществами пища.
  4. Уделить время своему хобби (рукоделие, кулинария, чтение).
  5. Расслабить свое тело, дав ему легкую и умеренную физическую нагрузку (плавание, прогулка, йога).
  6. Посетить психолога, либо поговорить о проблемах с родственниками, близкими друзьями.

Как восстановить месячные после стресса медикаментами

Стресс перед месячными может подействовать с такой силой, что самостоятельные методы борьбы с ним окажутся неэффективными. Тогда на помощь придет врач, который выпишет медикаментозное лечение. Среди препаратов, помогающих справиться с задержкой месячных по причине стресса, выделяют две основные группы: седативные лекарства и витаминные комплексы.

Седативные медикаменты в разы уменьшают беспокойство и помогают организму успокоиться, расслабиться. Такие препараты имеют минимум побочных действий и крайне эффективны. Вот список наименований:

  1. Афобазол.
  2. Тенотен.
  3. Персен.
  4. Неврофлус.
  5. Ново-пассит.

В крайних случаях назначают ноотропные препараты, влияющие на механизмы передачи импульсов в головном мозге. Вариант против задержки месячных эффективный, но более неприятный в плане побочных реакций.

Важно! Наименование препарата и дозировка определяются врачом.

Вторая группа препаратов – это витаминные комплексы и другие биологически активные вещества. Вот примеры наименований:

  1. Гинелон.
  2. Ваг Форте.
  3. Гинеконорм.
  4. ФеминалЭкомед.
  5. Префемин.
  6. Супрадин.
  7. Магне В6.
  8. Компливит.
  9. Берокка.

Народные средства

Лекарственные травы, доступные в любой аптеке, содержат успокаивающие вещества. Заваривание отваров из этих трав помогает побороть влияние стрессов на задержку месячных. Из чего можно приготовить такие отвары:

  • ромашка,
  • мята,
  • зверобой,
  • пустырник,
  • валериана,
  • мелисса,
  • шишки хмеля,
  • рута.

Еще одно народное средство для борьбы со стрессом – это ароматерапия. На рынке можно найти аромасвечи и аромамасла с приятными и успокаивающими запахами мяты, лаванды, сосны, ванили, хвои.

Профилактические меры

Профилактика задержки месячных основана на тех же принципах, что и лечение. Для предупреждения развития проблем с менструальным циклом достаточно:

  1. Минимизировать уровень стрессовых факторов.
  2. Высыпаться.
  3. Заниматься хобби.
  4. Позволять себе активный отдых в виде плавания или йоги.
  5. Правильно питаться.
  6. Нормализовать свой график.

Заключение

Задержка месячных из-за стресса – это распространенное явление, с которым сталкиваются женщины разного возраста в сложные периоды жизни. Бояться этого не надо, но профилактика и лечение задержки, связанной со стрессом, – это важный пункт в сохранении женского здоровья.

Отзывы

Боженова Инна Владимировна, 24 года, г. Воронеж У меня вообще были непрекращающиеся месячные длительностью в 3 месяца. Сотни посещений врача, десятки УЗИ, куча анализов – ничего страшного у меня не нашли. Я была здорова! Врач сказала, что это все из-за стресса.

Я тогда влюбилась в парня, а он меня бросил. Типичная женская история. Наверное, поэтому у меня иммунитет к чувствам: защитная реакция организма от стресса. Новикова Светлана Константиновна, 22 года, г.

Москва «Месячные начались раньше из-за стресса», – так сказал мне врач на осмотре. Может быть, это из-за того, что я развелась, потому что тогда я действительно сильно переживала. Но я знаю, что чаще всего возникает задержка месячных.

Так, у моей подруги задержка была около года из-за стресса на почве смерти отца. Эх, как все-таки это сильно сказывается на здоровье.

Что делать при задержке месячных после стресса

У здоровой женщины цикл месячных должен быть регулярным и стабильным. Он отвечает за нормальное функционирование репродуктивной системы.

Цикл должен длиться около 28 дней, однако медики допускают небольшие отклонения от нормы. В течение всей жизни он должен иметь одинаковую продолжительность.

Однако, зачастую, у большинства представительниц прекрасного пола можно наблюдать, что цикл не соответствует нормам.

Содержание:

На это могут повлиять совершено разнообразные причины, которые неблагоприятно сказываются на женском организме. Самой распространенной причиной нестабильного цикла является стресс. Он считается психическим недугом, который воздействует на весь организм в целом.

Ежедневно человек подвергается различным стрессовыми ситуациям, таким как проблемы на работе или в отношениях с близкими людьми. Поэтому для каждой девушки крайне важно знать, возможна ли задержка месячных после стресса.

Стресс – это своего рода защитный механизм организма, ограждающие его от любых внешних раздражителей. Причинами его появления могут быть:

  • сильное напряжение;
  • неприятные эмоции;
  • физическое напряжение;
  • любые проблемы.

При наличии стрессового состояния в организме происходят изменения, как на психическом, так и на физиологическом уровне. Человек становится раздражительным, может появиться чувство подавленности. И вместе с этим возникают проблемы со сном, может отсутствовать аппетит. Полается, что все внутренние органы подвергаются воздействию данного недуга.

Поэтому важно понять, может ли стресс повлиять на месячные. Репродуктивная система в этот момент становится очень уязвимой, так как при стрессе вырабатывается большое количество гормонов, которые приводят к изменениям в гормональном фоне.

Внимание! Стресс может быть вызван не только эмоциональными, но и физическими факторами. Например, рождение ребенка, травмирование, перенесенная операция. Все это воздействует на внутренние женские органы.

При затяжном эмоциональном стрессе изменяется работа эндокринной системы, происходит уменьшение тимуса. А также увеличивается размер надпочечников и вырабатывается в большом количестве пролактин. Как правило, данный гормон увеличивается во время беременности и продолжает оставаться в повышенном состоянии до тех пор, пока происходит кормление ребенка грудью.

Этот гормон влияет на репродуктивную систему, и под его воздействием изменяется секреция прогестерона. А он, в свою очередь, «в ответе» за нормальный цикл месячных. Помимо этого, гормон отвечает за:

  • иммунитет;
  • синтез пептидов;
  • работу щитовидной железы;
  • белковый обмен.

Так, на сколько могут задержаться месячные при стрессе? Чаще всего, под его воздействием происходит увеличение цикла – примерно он может составлять около 32 дней.

Однако не исключается полное отсутствие месячных, при наличии высокого уровня пролактина в крови. У некоторых женщин месячные могут пропасть на несколько лет. В медицине это называет аменорея.

Помимо этого, также могут наблюдаться другие симптомы, такие как частые головные боли или увеличивается масса тела.

Что делать, если случилась задержка месячных от стресса? В первую очередь необходимо посетить врача, для того чтобы он установил причину, которая повлияла на задержку.

В том случае, если подтверждается факт того, что задержка и стресс взаимосвязаны, необходимо приступить к незамедлительному лечению. Придется пересмотреть рацион питания, поменять образ жизни.

При правильном лечении можно вернуть нормальный менструальный цикл.

Если человек получил сильное эмоциональное напряжение, то ему необходимо больше времени отдыхать. Лучше всего взять отпуск на работе и отправиться в путешествие. Смена обстановки положительно влияет на эмоциональное состояние.

Также необходимо уделять достаточное время сну. Продолжительность здорового сна составляет около 7-8 часов. Нужно рано ложиться спать – ученные считают, что 10 часов вечера – самое оптимальное время для отхода ко сну. Помимо этого, в вечернее время не рекомендуется смотреть фильмы или передачи, в которых присутствуют насильственные и страшные сцены.

Важно! Не стоит соблюдать диету при стрессе, так как это спровоцирует ухудшение психологического состояния. Важно питаться правильно и сбалансированно.

В рационе должны быть продукты, которые содержат в себе значительное количество питательных веществ. Поэтому рекомендуется употреблять побольше овощей и фруктов, которые обогащены природными витаминами и минералами. Ведь они так необходимы при эмоциональном напряжении.

Из ежедневного рациона нужно исключить жирную и высококалорийную еду, также отказаться от продуктов, которые имеют искусственные красители. Запрещается есть фаст-фуд и употреблять спиртные напитки.

Чтобы восстановить после стресса месячный цикл, необходимо получать как можно больше радостных и позитивных эмоций. Также для того, чтобы вылечить стресс и вернуть месячные, нужно уделять время физическим нагрузками – они приведут мышцы в тонус, улучшат кровообращение. Для борьбы со стрессом специалисты советуют заниматься йогой, выполнять утреннюю гимнастику или медитацию.

Может ли быть задержка из-за стресса? Из выше изложенного понятно, что да. А вот как вернуть месячный цикл, и чтобы задержка исчезла, какие медикаментозные препараты для этого нужно пить?

Как правило, врач назначает пациентам лекарственные средства на основе растительных веществ. Они направлены на восстановление нормального психического состояния. Самыми эффективными считаются следующие лекарства:

  • Персен;
  • Тенотен;
  • Афобазол;
  • Ново-пасит.

Пить их рекомендуется по назначению лечащего врача, потому как на основе обследования он определяет стадию развития болезни, и уже после назначает длительность лечения и дозировку препарата. Данные лекарственные средства имеют небольшое количество побочных действий. Однако можно употреблять настойку пустырника или валерьяну, так как они абсолютно безопасны для организма.

Кроме этого, пациентке могут быть назначены витаминные комплексы для нормализации месячных. Чаще всего, это гомеопатические средства:

  • Префемин;
  • Ваг Форте;
  • Гинеконорм;
  • Гинелон.

Терапия с помощью лекарств назначается, когда невозможно устранить эмоциональные нарушения с помощью других способов лечения. А также, когда стресс имеет затяжной характер.

Травяные сборы очень часто используются в народной медицине. Они эффективно борются с различными заболеваниями, также их можно применять для лечения стресса и устранения задержки месячных.

Растения имеют в своем составе большое количество витаминов и микроэлементов, которые эффективно справляются с нервными нарушениями.

Однако, прежде чем принимать какое-либо народное средство на основе трав, необходимо проконсультироваться с доктором. Ведь они могут иметь противопоказания.

Если задержка была спровоцирована стрессом, то самые эффективные рецепты такие:

  • настойка из петрушки. Нужно взять 2 ст. ложки растения, мелко его измельчить и залить 1⁄2 л горячей воды. Далее средство варится на умеренном огне около 10 минут. После необходимо дать ему настояться и остыть в течение 30 минут. Пить отвар нужно начать за неделю до предполагаемой даты менструации. Употреблять нужно 2 раза в день по 120 мл;
  • настойка из корня одуванчика. Необходимо 1 ч. ложку растения измельчить и залить 250 мл горячей воды. Затем поставить на тихий огонь и варить в течение 15 минут. После отвар должен настаиваться на протяжении 2-х часов. Употреблять средство рекомендуется два раза в день по 120 мл. Как правило, курс лечения длится около 30 дней.

После этого менструальный цикл должен прийти в норму, и иметь продолжительность, как раньше.

В первую очередь женщине необходимо следить за своим здоровьем. Именно женский организм сильнее всего подвержен стрессовым ситуациям, так как восприимчивость более чувствительна к внешним факторам.

Конечно, лучше всего избегать стрессов. Однако в современном мире это выполнить довольно сложно. Поэтому необходимо заниматься профилактикой стресса, научиться меньше реагировать на внешние раздражители.

Также очень важно поддерживать иммунитет во время сезонных простуд. Ведь ослабленная иммунная система не сможет бороться с негативными факторами. Важно соблюдать правильный образ жизни, есть только полезные продукты. Рекомендуется, для предотвращения стрессовых ситуаций, расписать распорядок дня. Стараться делать небольшие перерывы во время работы.

Крайне важно в выходные дни полноценно отдыхать для того, чтобы организм расслабился и восстановился после сложной трудовой недели. Лучше всего осуществлять поездки за город или пешие прогулки по лесу. Природа способствует снятию нервного напряжения, и тем самым восстанавливает эмоциональный фон.

Специалисты советуют записаться в спортзал или бассейн, так как физические нагрузки положительно влияют и на психическое, и физическое состояние. Лучше всего тренироваться по 3 раза в неделю. В целях профилактики стресса можно найти для себя новое занятие, например, научиться рисовать, вышивать, вязать. Творчество позволяет психике расслабляться.

Как только прекратится развитие психического недуга, нормализуется менструальный цикл и улучшится работа всего организма.

Как ни странно, бывают и стрессы, которые вызваны приятными эмоциями. Например, ели женщина отправилась на отдых в жаркую страну, то задержка ей гарантирована.

По этой причине многих интересует вопрос, на сколько может быть задержка месячных после стресса, которая связана с изменением климата. Как правило, цикл может сбиться на несколько дней, примерно на одну неделю. Также на задержку может повлиять переезд на новую квартиру или в другой город.

Стоит учитывать, что иногда стресс вызван не только внешними раздражителями. Большинство девушек придерживаются строгих диет для того, чтобы находиться в прекрасной форме.

Однако они могут спровоцировать внутренний стресс в организме, так как тело не получает необходимых питательных веществ для полноценной работы. Такое питание приводит к тому, что кровеносная система не способна работать полноценно и выполнять все свои функции.

Поэтому, как следствие, могут возникнуть обильные кровотечения или месячные и вовсе пропадают.

Сильные стрессовые ситуации приводят к изменениям в гормональном фоне, тем самым провоцируют сбой в менструальном цикле. Для того чтобы восстановить организм после нервного переживания, необходимо комплексно подходить к лечению.

А еще крайне важно для женского здоровья регулярно наблюдаться у гинеколога.

Может ли быть задержка на фоне стрессовых ситуаций

Расстройства менструального цикла – важная проблема для медицины. В современном мире многие женщины сталкиваются с таким явлением, как задержка месячных из-за стресса. Чтобы разобраться в опасности данного состояния, необходимо иметь представление о причинах его развития, а также основных методах устранения.

Нарушения цикла могут быть по разным причинам

Как стресс влияет на менструацию

Стресс является естественной реакцией организма человека на ряд внешних и внутренних неблагоприятных факторов. Основными причинами стресса для женщин являются:

  • эмоциональное перенапряжение;
  • нерациональное питание;
  • тяжёлая физическая работа;
  • частые переохлаждения.

Сильные переживания способствуют повышению нагрузки на нервную систему представительниц слабого пола. Вследствие этого женский организм перестаёт справляться с ситуацией и даёт сбой, при котором развиваются различные проблемы со здоровьем.

Мочеполовая система представительниц слабого пола одной из первых реагирует на стресс. Наиболее подвержены дисфункциям яичники, что сопровождается снижением синтеза прогестерона и эстрогена.

Также нервные потрясения негативно сказываются на работе структур головного мозга. При этом происходит нарушение выработки гормонов гипоталамуса и гипофиза.

Стрессовые состояния способствуют изменению гормонального фона в организме, вследствие чего может отмечаться сбой менструального цикла.

Патология может возникать на фоне стресса

Задержка месячных на фоне стресса усугубляется переживаниями женщины по поводу возникших проблем с её здоровьем. Вследствие этого происходит образование порочного круга, вывести из которого может только высококвалифицированный специалист. В некоторых случаях при стрессовой аменорее вместе с гинекологом требуется консультация психотерапевта.

Может ли быть задержка

Изменения в менструальном цикле вследствие стрессов – достаточно распространённое явление. Оно обусловлено тем, что при эмоциональных нагрузках происходят нарушения гормонального фона, а также расстройства в работе многих органов и систем.

Поражение структур нервной системы сопровождается нарушениями в работе эндокринных желез, вследствие чего происходит изменения процессов менструального цикла. По этой причине у женщин могут отмечаться задержки месячных.

Какие ещё есть причины нарушения

Основной причиной расстройства цикла менструаций у женщин является беременность. Во время этого периода они вступают в период климакса, поэтому месячные не выделяются.

Причиной сбоя цикла может быть и заболевание мочеполовой системы

Также среди факторов, провоцирующих задержку, стоит выделить:

  • заболевания органов мочеполовой системы;
  • нарушения гормонального фона;
  • новообразования в репродуктивных органах;
  • приём некоторых медикаментозных средств;
  • сахарный диабет обоих типов.

Наследственная предрасположенность тоже влияет на течение цикла менструаций. Она может провоцировать развитие гормонального дисбаланса, что является поводом для постоянного наблюдения женщины у эндокринолога и гинеколога.

Не стоит забывать о том, что организм индивидуален. По этой причине реакции на какие-либо изменения могут отличаться друг от друга.

Для установки этиологии сбоя менструального цикла рекомендуется обращаться к профильным специалистам. Они смогут диагностировать провоцирующий фактор и назначить необходимое лечение, что поможет вернуть функции органам репродуктивной системы.

Очень важно вовремя обратиться к врачу

Как бороться с задержкой медикаментами

Лечение задержки при стрессе заключается в стабилизации эмоционального состояния женщины. При отсутствии возможности устранения стрессового фактора врач может назначать седативные препараты на основе лекарственных трав. Данные средства способствуют нормализации психического состояния максимально мягко.

При этом нужно помнить о возможных побочных эффектах успокоительных препаратов. К ним относятся:

  • аллергические реакции;
  • расстройства мочевыделительной функции;
  • снижение активности работы головного мозга;
  • нарушения процессов пищеварения.

Помимо этого, для поддержки функционирования структур нервной системы могут использоваться витаминные комплексы.

Эффект данных средств направлен на стабилизацию психического состояния пациентки при стрессе и задержке месячных.

Как используются народные средства для восстановления цикла

Восстановление нормального течения менструаций возможно и без использования медикаментозных препаратов. Для этой цели применяются рецепты нетрадиционной медицины, которые состоят исключительно из натуральных компонентов.

КомпонентыЭффект на организм
Петрушка и розмарин Эти ингредиенты рекомендуется добавлять как приправу в первые блюда или салаты. Они оказывают тонизирующее воздействие на организм
Свежевыжатый сок сельдерея и моркови Использование этого напитка снимает напряжение, а также улучшает общее состояние здоровья
Ароматические масла с мелиссой и лавандой Они обладают успокоительным эффектом, который способствует нормализации функций нервной системы

Если у женщины пропали месячные из-за стресса и положительный эффект в результате использования данных методов не наблюдается, врач обязан сменить тактику лечения. В таких случаях назначается приём гормональных средств.

Посмотрев это видео, вы узнаете о влиянии стресса на менструацию:

Как предотвратить задержку

Чтобы женщине предотвратить нарушение менструаций вследствие стрессов, врачи рекомендуют придерживаться ряда правил, которые существенно снижают вероятность патологических процессов. К ним относятся:

  1. Сбалансированное питание.
  2. Корректировка уровня физических нагрузок.
  3. Нормализация режима сна.
  4. Избегание конфликтных ситуаций.
  5. Приём витаминов и успокоительных препаратов.
  6. Своевременное посещение психотерапевта.

Продолжительность задержки месячных при стрессе может составлять более полугода. Не стоит затягивать с походом к специалисту. Устранение стресса и его последствий позволит нормализировать цикл менструации, что предотвратит развитие осложнений в будущем.

7 советов психологов для восстановления месячных после стресса

Стресс — период адаптации организма к новым условиям. Ресурсы человека мобилизуются, активируются защитные системы, повышается уровень адреналина, тестостерона и кортизола, потому задержка месячных из-за стресса случается довольно часто. Чем сильнее переживания, тем сильнее гормональный дисбаланс.

Как стресс влияет на месячные?

Стресс — обобщенное название всех ситуаций, внешних факторов и условий, выходящих за рамки привычной для человека зоны комфорта. Эти изменения бывают как неприятными, так и приятными:

  • недосып;
  • эмоциональные перегрузки;
  • тревога из-за предстоящей свадьбы, выступления, экзамена, переезда;
  • конфликты на работе, с друзьями, в семье;
  • жесткие диеты, голодание;
  • физическое или интеллектуальное истощение, переутомление;
  • смена климата.

Стресс вызывает эмоциональное и психофизиологическое напряжение. Меняется активность гипоталамуса и гипофиза — отделов мозга, которые отвечают за выработку женских гормонов. Выраженность стресса зависит исключительно от восприятия женщины, ее устойчивости и чувствительности.

Месячные и стресс связаны напрямую: чем сильнее и продолжительнее эмоциональное потрясение, тем дольше задерживается цикл. Единичное потрясение вызывает задержку в 2-5 дней, хронический стресс способен вызвать аменорею, которая длится годами.

Может ли быть задержка месячных из-за стресса?

Стресс бывает двух видов: острый и хронический. В первом случае речь идет об одном сильном потрясении, во втором — о регулярных мелких неприятностях. Однако месячные могут пропасть в обоих случаях. У некоторых женщин наблюдается обратная реакция: регулы приходят на 3-4 дня раньше или слишком долго идут месячные.

На сколько может быть задержка месячных после стресса?

Продолжительность сбоя зависит от уровня напряжения, психических и физиологических особенностей женщины. В среднем менструация наступает на 4-5 дней позже, то есть если цикл 28 дней, то он превратится в 32-дневный. Такая задержка считается допустимой.

Отсутствие регул месяц и дольше — повод для беспокойства.

Что делать, если из-за стресса пропали месячные?

Прежде всего нужно убедиться в отсутствии беременности. В этом поможет диагностический тест и консультация гинеколога. Если беременности нет, то для нормализации месячных необходимо восстановить психическое равновесие. Прием гормональных средств, стимулирование цикла в данном случае используется как вспомогательный метод.

Важно повышать стрессоустойчивость, укреплять нервную систему организма, чтобы состояние не стало хроническим, а стресс не превратился в депрессию.

Как вернуть месячные:

  1. Найти причину беспокойства. Справиться с психологической травмой, изменить образ и условия жизни.
  2. Расслабляться. Отдыхать доступным и любимым способом. Это может быть прием теплой ароматической ванны, шопинг, встреча с друзьями, медитация, йога, выходные на природе. Нужно использовать все, что приносит больше позитивных эмоций.
  3. Соблюдать режим труда, отдыха, сна. В период стресса и сбоя менструального цикла восьмичасовой сон имеет особое значение: вырабатывается мелатонин (гормон сна), который нейтрализует кортизол (гормон стресса). Оптимальное время для отхода ко сну — 10-11 часов вечера, для подъема — 6-7 часов утра.
  4. Следить за рационом. Питание должно быть сбалансированным: много белка, чуть меньше сложных углеводов, много клетчатки (овощи и фрукты), обильное питье. Нужно исключить консервы и полуфабрикаты, уменьшить потребление сахара. Но разрешено и полезно есть мед. Не рекомендуется голодать, ограничивать себя в любимых блюдах. Диеты не вызывают позитивных эмоций и провоцируют дополнительное повышение уровня кортизола.
  5. Найти хобби, пополняющее запасы энергии. Кулинария, чтение, музыка, театр, танцы, спорт, творчество.
  6. Использовать аромамасла. Их можно добавлять в воду, распылять по комнате, капать на запястье вместо духов или использовать при самомассаже. При стрессе помогает лавандовое и анисовое масло.
  7. Пройти курс приема витаминов. Магне В6 и Компливит хорошо восстанавливают нервную систему, оказывают положительное влияние на здоровье женщин, в частности работу репродуктивной системы.

Если подручные средства не помогают, причина стресса неясна или справиться с ней своими силами невозможно, то полезно посетить психолога. Согласно индивидуальным психологическим особенностям он подберет план восстановления психического здоровья, познакомит с методами профилактики тревоги и повышения стрессоустойчивости.

Как восстановить месячные после стресса?

Восстановить месячные помогут травы: мелисса, зверобой, ромашка, розмарин, валериана, пустырник или готовый аптечный успокаивающий сбор. Их можно применять наружно и принимать внутрь:

  • теплые ванны с добавлением отвара;
  • чай из ромашки и мелиссы;
  • салат с добавлением петрушки, розмарина.

Эффект от ванн будет сильнее, если пройти курс — не менее 10 процедур. Продолжительность одного сеанса — 20 минут. Вода должна соответствовать температуре тела. Желательно проводить процедуру перед сном.

Если задержка цикла длится больше месяца, следует обратиться к врачу. Он проведет комплексное обследование, возьмет анализы на гормоны, обследует состояние матки и яичников. На основе полученных данных специалист поставит диагноз, а если причина не относится к гинекологии, направит к психотерапевту.

Кроме этого, консультация необходима, если идут аномально обильные, измененного цвета или скудные месячные. Любые изменения выделений могут свидетельствовать о патологии женских органов.

Почему бывает задержка после нервных потрясений или стресса?

Первопричина заключается в том, что женщина попадает в ситуацию, с которой не может справиться привычными способами, из-за поиска решения возникает напряжение и тревога, организм отвечает на опасность повышением уровня гормонов, пробуждающих силу, агрессию, выносливость. Цель организма — выжить. Функция деторождения отходит на второй план, уровень женских гормонов падает.

Могут ли пойти месячные раньше привычного срока?

Такое случается. Предсказать частные последствия гормонального сбоя нельзя.

Задержка месячных из-за стресса: сколько она длится и какое влияние оказывает на организм

Задержка месячных из-за стресса: сколько она длится и какое влияние оказывает на организм

Менструальный цикл – это значимый показатель женского здоровья. Если он регулярный и никаких беспокоящих симптомов нет, то гинеколога в профилактических целях можно посещать 1–2 раза в год. Сбои в цикле и задержка менструации могут говорить как о наступлении беременности, так и о возможных проблемах, поэтому срочная консультация специалиста необходима.

Чтобы знать среднюю продолжительность цикла, нужно понять, что же это такое. Менструальный цикл – это срок от первого дня месячных до первого дня следующих выделений. Организм каждой женщины уникален, поэтому средний срок цикла может варьироваться в пределах 21–32 дней. Главное, чтобы он был регулярным. Например, у одной женщины в разные месяцы цикл должен колебаться в пределах 1–2 дней, но не более. Нормальная продолжительность менструации также индивидуальна. У разных женщин она может составлять от 3 до 7 дней. Сбои в цикле и продолжительности месячных могут появляться по разным причинам, в том числе и из-за смены психоэмоционального состояния.

Как стресс влияет на менструацию

Стресс – одна из распространенных причин сбоев менструального цикла. Он является защитной реакцией организма и развивается в ответ на различные факторы: физическое перенапряжение, проблемы на работе или в семье и другое. Раздражительность, чувство подавленности, апатия, бессонница, нарушение аппетита – верные спутники стресса. Негативному воздействию подвержено не только эмоциональное состояние, но и весь организм, в том числе репродуктивная система.

Влияние пролактина. Под воздействием сильных эмоций происходят изменения в эндокринной железе, начинается усиленная выработка гормона пролактина в гипофизе. Это то самое вещество белковой природы, которое в норме синтезируется во время беременности и способствует нормальной лактации. Но в обычной ситуации оно не приносит пользы. Под его влиянием деятельность щитовидной железы замедляется, нарушается связь с гипофизом, возрастает уровень тиреотропного гормона. Это, в свою очередь, может привести к нарушению менструального цикла, что обычно проявляется в увеличении интервала между менструациями. Если концентрация пролактина слишком высока, месячные могут отсутствовать вообще.

Влияние кортизола. Во время стресса активизируется деятельность коры надпочечников, где синтезируется еще один гормон, влияющий на менструальный цикл, – кортизол. Это вещество стероидной природы, избыток которого негативно отражается на гормональном фоне женщине. Что может проявляться в росте волос на теле (по мужскому типу), жировых отложениях, ухудшении состоянии кожи. Если концентрация кортизола повышена в течение долгого времени, это может привести к появлению лишнего веса. Ожирение отрицательно сказывается на репродуктивной системе и может быть причиной синдрома поликистозных яичников.

Виды и причины стресса

Стресс может быть кратковременным или длительным. В первом случае он является естественной реакцией организма на негативные события и может быть даже полезным. Он помогает мобилизовать силы для решения проблемы и оставляет возможность восстановиться. Длительный стресс может стать причиной ряда проблем со здоровьем. Каждый вид стресса может быть вызван разными причинами, наиболее распространенными среди них являются следующие:

  • тяжелые физические нагрузки;
  • эмоциональные потрясения;
  • акклиматизация;
  • изменение образа жизни;
  • перенесенные травмы, операции;
  • проблемы на работе;
  • отсутствие взаимопонимания в семье и др.

Какая задержка считается нормой

Как говорилось выше, каждый организм индивидуален, поэтому индивидуальны и сбои в менструальном цикле. Если беременность не наступила и нет серьезных поводов для беспокойства, то задержка месячных обычно не превышает 5 дней. В тяжелых случаях отсутствие менструации может достигать нескольких месяцев и требует лечения.

Стоит отметить, что у подростков в период полового созревания менструальный цикл нестабилен. В течение двух лет с начала первого кровотечения он должен установиться.

Как бороться со стрессом

Стресс – проблема, с которой можно и нужно бороться. Ознакомьтесь с несколькими методами, которые доступны всем, но от этого не теряют своей эффективности.

Позвольте себе отдохнуть. В дело можно пустить все: от теплой ванны с маслами до велопрогулки, от шопинга до путешествия. Выберите то, что позволит максимально расслабиться и забыть о проблемах.

Добавьте положительных эмоций. Сделайте то, что принесет вам радость: встретьтесь с подругами, сходите на романтическое свидание, покатайтесь на аттракционах.

Обеспечьте полноценный сон. Женщине важно спать не менее 8 часов в сутки. Качественный ночной отдых – залог здоровья, хорошего самочувствия и прекрасного внешнего вида.

Питайтесь полноценно. Ежедневный рацион должен быть сбалансированным, включать фрукты, овощи, белки и сложные углеводы. Сильные ограничения и длительные строгие диеты могут нанести больше вреда, чем пользы.

Займитесь йогой. Медитация и занятия йогой – древние практики, которые помогают контролировать эмоции и избегать стресса.

Найдите хобби. Любимое занятие, пусть оно и кажется другим бесполезным, помогает найти отдушину, зарядиться положительными эмоциями, восстановить душевное равновесие. Это может быть чтение, кулинария, вязание, вышивка, конные прогулки, танцы или что-то другое.

Когда необходима помощь специалиста

Задержка менструации (особенно если она появляется часто) не является нормой. О регулярности цикла нужно проконсультироваться со специалистом – гинекологом. Если проблема заключается именно в стрессе, может потребоваться помощь психолога или психотерапевта. Проговаривая ситуации, вы сможете быстрее найти выход. Зачастую при стрессе пациенткам назначаются седативные препараты на основе трав, например Корвалол ФИТО.

Могут ли быть задержки месячных после стресса?

У здоровой женщины цикл месячных должен быть регулярным и стабильным. Он отвечает за нормальное функционирование репродуктивной системы. Цикл должен длиться около 28 дней, однако медики допускают небольшие отклонения от нормы. В течение всей жизни он должен иметь одинаковую продолжительность. Однако, зачастую, у большинства представительниц прекрасного пола можно наблюдать, что цикл не соответствует нормам.

На это могут повлиять совершено разнообразные причины, которые неблагоприятно сказываются на женском организме. Самой распространенной причиной нестабильного цикла является стресс. Он считается психическим недугом, который воздействует на весь организм в целом.

Ежедневно человек подвергается различным стрессовыми ситуациям, таким как проблемы на работе или в отношениях с близкими людьми. Поэтому для каждой девушки крайне важно знать, возможна ли задержка месячных после стресса.

Стресс – это своего рода защитный механизм организма, ограждающие его от любых внешних раздражителей. Причинами его появления могут быть:

  • сильное напряжение;
  • неприятные эмоции;
  • физическое напряжение;
  • любые проблемы.

При наличии стрессового состояния в организме происходят изменения, как на психическом, так и на физиологическом уровне. Человек становится раздражительным, может появиться чувство подавленности. И вместе с этим возникают проблемы со сном, может отсутствовать аппетит. Полается, что все внутренние органы подвергаются воздействию данного недуга.

Поэтому важно понять, может ли стресс повлиять на месячные. Репродуктивная система в этот момент становится очень уязвимой, так как при стрессе вырабатывается большое количество гормонов, которые приводят к изменениям в гормональном фоне.

Внимание! Стресс может быть вызван не только эмоциональными, но и физическими факторами. Например, рождение ребенка, травмирование, перенесенная операция. Все это воздействует на внутренние женские органы.

При затяжном эмоциональном стрессе изменяется работа эндокринной системы, происходит уменьшение тимуса. А также увеличивается размер надпочечников и вырабатывается в большом количестве пролактин. Как правило, данный гормон увеличивается во время беременности и продолжает оставаться в повышенном состоянии до тех пор, пока происходит кормление ребенка грудью.

Этот гормон влияет на репродуктивную систему, и под его воздействием изменяется секреция прогестерона. А он, в свою очередь, «в ответе» за нормальный цикл месячных. Помимо этого, гормон отвечает за:

  • иммунитет;
  • синтез пептидов;
  • работу щитовидной железы;
  • белковый обмен.

Так, на сколько могут задержаться месячные при стрессе? Чаще всего, под его воздействием происходит увеличение цикла – примерно он может составлять около 32 дней. Однако не исключается полное отсутствие месячных, при наличии высокого уровня пролактина в крови. У некоторых женщин месячные могут пропасть на несколько лет. В медицине это называет аменорея. Помимо этого, также могут наблюдаться другие симптомы, такие как частые головные боли или увеличивается масса тела.

Что делать, если случилась задержка месячных от стресса? В первую очередь необходимо посетить врача, для того чтобы он установил причину, которая повлияла на задержку. В том случае, если подтверждается факт того, что задержка и стресс взаимосвязаны, необходимо приступить к незамедлительному лечению. Придется пересмотреть рацион питания, поменять образ жизни. При правильном лечении можно вернуть нормальный менструальный цикл.

Если человек получил сильное эмоциональное напряжение, то ему необходимо больше времени отдыхать. Лучше всего взять отпуск на работе и отправиться в путешествие. Смена обстановки положительно влияет на эмоциональное состояние.

Также необходимо уделять достаточное время сну. Продолжительность здорового сна составляет около 7-8 часов. Нужно рано ложиться спать – ученные считают, что 10 часов вечера – самое оптимальное время для отхода ко сну. Помимо этого, в вечернее время не рекомендуется смотреть фильмы или передачи, в которых присутствуют насильственные и страшные сцены.

Важно! Не стоит соблюдать диету при стрессе, так как это спровоцирует ухудшение психологического состояния. Важно питаться правильно и сбалансированно.

В рационе должны быть продукты, которые содержат в себе значительное количество питательных веществ. Поэтому рекомендуется употреблять побольше овощей и фруктов, которые обогащены природными витаминами и минералами. Ведь они так необходимы при эмоциональном напряжении.

Из ежедневного рациона нужно исключить жирную и высококалорийную еду, также отказаться от продуктов, которые имеют искусственные красители. Запрещается есть фаст-фуд и употреблять спиртные напитки.

Чтобы восстановить после стресса месячный цикл, необходимо получать как можно больше радостных и позитивных эмоций. Также для того, чтобы вылечить стресс и вернуть месячные, нужно уделять время физическим нагрузками – они приведут мышцы в тонус, улучшат кровообращение. Для борьбы со стрессом специалисты советуют заниматься йогой, выполнять утреннюю гимнастику или медитацию.

Может ли быть задержка из-за стресса? Из выше изложенного понятно, что да. А вот как вернуть месячный цикл, и чтобы задержка исчезла, какие медикаментозные препараты для этого нужно пить?

Как правило, врач назначает пациентам лекарственные средства на основе растительных веществ. Они направлены на восстановление нормального психического состояния. Самыми эффективными считаются следующие лекарства:

  • Персен;
  • Тенотен;
  • Афобазол;
  • Ново-пасит.

Пить их рекомендуется по назначению лечащего врача, потому как на основе обследования он определяет стадию развития болезни, и уже после назначает длительность лечения и дозировку препарата. Данные лекарственные средства имеют небольшое количество побочных действий. Однако можно употреблять настойку пустырника или валерьяну, так как они абсолютно безопасны для организма.

Кроме этого, пациентке могут быть назначены витаминные комплексы для нормализации месячных. Чаще всего, это гомеопатические средства:

  • Префемин;
  • Ваг Форте;
  • Гинеконорм;
  • Гинелон.

Терапия с помощью лекарств назначается, когда невозможно устранить эмоциональные нарушения с помощью других способов лечения. А также, когда стресс имеет затяжной характер.

Травяные сборы очень часто используются в народной медицине. Они эффективно борются с различными заболеваниями, также их можно применять для лечения стресса и устранения задержки месячных. Растения имеют в своем составе большое количество витаминов и микроэлементов, которые эффективно справляются с нервными нарушениями. Однако, прежде чем принимать какое-либо народное средство на основе трав, необходимо проконсультироваться с доктором. Ведь они могут иметь противопоказания.

Если задержка была спровоцирована стрессом, то самые эффективные рецепты такие:

  • настойка из петрушки. Нужно взять 2 ст. ложки растения, мелко его измельчить и залить 1⁄2 л горячей воды. Далее средство варится на умеренном огне около 10 минут. После необходимо дать ему настояться и остыть в течение 30 минут. Пить отвар нужно начать за неделю до предполагаемой даты менструации. Употреблять нужно 2 раза в день по 120 мл;
  • настойка из корня одуванчика. Необходимо 1 ч. ложку растения измельчить и залить 250 мл горячей воды. Затем поставить на тихий огонь и варить в течение 15 минут. После отвар должен настаиваться на протяжении 2-х часов. Употреблять средство рекомендуется два раза в день по 120 мл. Как правило, курс лечения длится около 30 дней.

После этого менструальный цикл должен прийти в норму, и иметь продолжительность, как раньше.

В первую очередь женщине необходимо следить за своим здоровьем. Именно женский организм сильнее всего подвержен стрессовым ситуациям, так как восприимчивость более чувствительна к внешним факторам. Конечно, лучше всего избегать стрессов. Однако в современном мире это выполнить довольно сложно. Поэтому необходимо заниматься профилактикой стресса, научиться меньше реагировать на внешние раздражители.

Также очень важно поддерживать иммунитет во время сезонных простуд. Ведь ослабленная иммунная система не сможет бороться с негативными факторами. Важно соблюдать правильный образ жизни, есть только полезные продукты. Рекомендуется, для предотвращения стрессовых ситуаций, расписать распорядок дня. Стараться делать небольшие перерывы во время работы.

Крайне важно в выходные дни полноценно отдыхать для того, чтобы организм расслабился и восстановился после сложной трудовой недели. Лучше всего осуществлять поездки за город или пешие прогулки по лесу. Природа способствует снятию нервного напряжения, и тем самым восстанавливает эмоциональный фон.

Специалисты советуют записаться в спортзал или бассейн, так как физические нагрузки положительно влияют и на психическое, и физическое состояние. Лучше всего тренироваться по 3 раза в неделю. В целях профилактики стресса можно найти для себя новое занятие, например, научиться рисовать, вышивать, вязать. Творчество позволяет психике расслабляться.

Как только прекратится развитие психического недуга, нормализуется менструальный цикл и улучшится работа всего организма.

Как ни странно, бывают и стрессы, которые вызваны приятными эмоциями. Например, ели женщина отправилась на отдых в жаркую страну, то задержка ей гарантирована.

По этой причине многих интересует вопрос, на сколько может быть задержка месячных после стресса, которая связана с изменением климата. Как правило, цикл может сбиться на несколько дней, примерно на одну неделю. Также на задержку может повлиять переезд на новую квартиру или в другой город.

Стоит учитывать, что иногда стресс вызван не только внешними раздражителями. Большинство девушек придерживаются строгих диет для того, чтобы находиться в прекрасной форме. Однако они могут спровоцировать внутренний стресс в организме, так как тело не получает необходимых питательных веществ для полноценной работы. Такое питание приводит к тому, что кровеносная система не способна работать полноценно и выполнять все свои функции. Поэтому, как следствие, могут возникнуть обильные кровотечения или месячные и вовсе пропадают.

Сильные стрессовые ситуации приводят к изменениям в гормональном фоне, тем самым провоцируют сбой в менструальном цикле. Для того чтобы восстановить организм после нервного переживания, необходимо комплексно подходить к лечению.

А еще крайне важно для женского здоровья регулярно наблюдаться у гинеколога.

Почему бывает задержка месячных — Wonderzine

]]>

ольга лукинская

Отсутствие месячных, когда по календарю им пора начаться, может напугать — особенно если менструальный цикл всегда отличался регулярностью. Преждевременное кровотечение тоже способно породить панику — и всё же каждый раз срочно бежать к врачу необязательно (правда, мы исходим из того, что вы показываетесь гинекологу каждый год). Организм человека чувствителен к самым разным воздействиям, и на такую тонкую вещь, как гормональное равновесие, могут повлиять неожиданные факторы. Разбираемся, когда всё-таки нужно бить тревогу, а когда на сбой менструального цикла можно не обращать внимания. 

Стресс

Воспринимаемый уровень стресса в одном из исследований коррелировал с нерегулярностью менструального цикла. При этом фоновый стресс, например связанный с каждодневной работой, особенно если он негативный, может способствовать и развитию предменструального синдрома, и болезненным месячным. Многие женщины жалуются на внеочередные месячные после перелёта — объяснений этому пока не найдено, но в некоторых исследованиях была подтверждена более частая нерегулярность цикла у стюардесс.

Причиной может быть и стресс во всех его проявлениях — смена обстановки и климата, изменение активности и питания, — и сбой циклических процессов в организме из-за смены часовых поясов. В норме менструальный цикл длится от 21 до 35 дней, и колебания в этих пределах не считаются отклонениями — а лишь отражают чувствительность организма. 

Приём гормональных препаратов

На фоне гормональных контрацептивов овуляции не происходит — а значит, нет и менструации. Традиционные таблетки разработаны так, чтобы раз в месяц происходило кровотечение отмены — и придумано это было шестьдесят лет назад для «успокоения» женщин, чтобы им не казалось, что месячные исчезли.

Сегодня знаний о том, как устроен наш организм, намного больше — и смысла в искусственно созданных кровотечениях практически нет. Поэтому появляются новые средства, при использовании которых кровотечения возникают раз в три месяца — или вовсе исчезают. Чтобы это не стало неожиданностью, достаточно изучить инструкцию по применению препарата; помните, что не все побочные эффекты неблагоприятны, а называются они побочными потому, что отличны от цели применения лекарства. 

Перименопауза

Это период, когда организм постепенно готовится к менопаузе, окончанию репродуктивного периода. У некоторых женщин этот процесс может начинаться около тридцати пяти или сорока лет. Это не значит, что скоро наступит климакс — впереди может быть ещё пятнадцать фертильных лет, в ходе которых будут происходить плавные гормональные изменения, которые выражаются в том числе в нерегулярности менструального цикла.

Это длительный процесс, и хороший гинеколог-эндокринолог на регулярных приёмах поможет в нём сориентироваться и поддерживать хорошее самочувствие. Срочно стоит обратиться к врачу, если кровотечения, наоборот, слишком обильные, частые и долгие — это может быть признаком заболеваний, требующих лечения. 

Истощение или набор веса

Нарушения менструального цикла часто сопровождают набор или сильная потеря веса и могут включать нерегулярные месячные и даже их полное отсутствие. При значительных отклонениях веса тела от нормального нарушается метаболизм — и, поскольку разные эндокринные процессы в нашем организме тесно связаны между собой, под удар попадают все связанные с действием гормонов функции, включая репродуктивную. Конечно, в таком случае обращаться за помощью стоит, и не только к гинекологу — нужно устранять первопричину, например, лечить нервную анорексию, и нормализовать массу тела. 

Беременность

Конечно, задержка менструации — повод сделать тест на беременность, если в недавнем прошлом у вас был секс и вы не пользуетесь высокоэффективными средствами контрацепции. Кровотечение, правда, тоже не всегда подтверждает, что всё под контролем: бывает, что беременность наступает и прерывается на очень раннем сроке, что выглядит, как обильная и болезненная менструация, начавшаяся почти вовремя. Поэтому лучше всё-таки использовать надёжные методы контрацепции, не подвергая организм дополнительному стрессу. Если месячные сильно отличаются от обычных — долгие, болезненные, с температурой, — покажитесь врачу. 

Фотографии: Claudio Divizia — stock.adobe.com, phant — stock.adobe.com

может ли пропасть менструация на нервной почве?

Регулярный менструальный цикл – показатель, отражающий состояние женского здоровья. В норме кровянистые выделения продолжаются 3-5 суток и начинаются с одинаковым интервалом – раз в 25-32 дней. Сильный стресс или психоэмоциональное потрясение пагубно влияют на организм женщины, вызывая множество проблем, в том числе сбои цикла. Насколько может быть опасна задержка месячных после стресса, и как восстановить нормальную работу половой системы?

Влияние стресса на месячные

Существует ли связь между нервной системой и органами малого таза? Да, и самая прямая. За выработку половых гормонов отвечает гипофиз – небольшой отдел в нижней части головного мозга. В момент сильного стресса в мозг посылается сигнал тревоги, который провоцирует нарушения работы различных органов, в том числе и половой сферы.

Сколько дней может составлять задержка из-за нервов? От того, насколько сильным и продолжительным был стресс, зависит длительность задержки месячных. Небольшая перегрузка на работе или конфликт с начальством могут никак не отразиться на приходе менструации. Напротив, хроническая усталость, недосыпание, проблемы в личной жизни или потеря близкого человека могут нанести сильнейший удар по организму, вызвав аменорею – месячные могут пропасть на 1 год и более.

Почему на нервной почве могут пропасть месячные?

Эмоциональное потрясение оказывает прямое влияние на выработку половых гормонов. Под действием стресса происходит выброс в кровь адреналина и норадреналина. При повышенной концентрации этих веществ человек испытывает злость, агрессию, наблюдается гиперактивность, появляется чрезмерная работоспособность. Так организм пытается защититься от эмоциональной перегрузки. По этой же причине выработка прогестерона замедляется – менструальный цикл не может начаться вовремя.

Сбой в цикле может произойти не только под влиянием негативных эмоций. Чрезмерная радость, вызванная свадьбой или рождением детей, поездка на море, долгожданная встреча с близким человеком аналогичным образом меняют гормональный фон и могут спровоцировать задержку.

Другие факторы, способные повлиять на регулярность цикла:

  • тяжелые физические нагрузки – работа на высоте, тренировки высокой интенсивности, чрезмерная трудовая активность;
  • строгая диета, нарушающая обмен веществ;
  • акклиматизация при смене климатических поясов;
  • перенесенные травмы и операции.

Сколько дней задержки считаются нормой?

Продолжительность задержки напрямую зависит от величины и регулярности эмоционального потрясения. Обычно месячных нет около 5 дней, затем выделения приходят самостоятельно, без лекарственной терапии. Данный срок может быть увеличен или уменьшен. В редких случаях месячные сдвигаются на 30 календарных дней, то есть продолжительность одного цикла составляет 56-64 суток.

Срок задержки зависит от индивидуальных особенностей организма и его способности противостоять эмоциональным перегрузкам. Обычно женщине требуются пару дней отдыха, чтобы привести в порядок нервную и гормональную систему. Нередки случаи, когда самостоятельно справиться с проблемой не удается. В такой ситуации необходима помощь психолога, иначе на нервной почве может начаться депрессия, которая приведет к аменорее – полной потере месячных.

Что делать?

Сбой цикла на фоне стресса относится к непатологическим факторам и в большинстве случаев не требует особой терапии и врачебного вмешательства. С данной проблемой можно справиться самостоятельно. Обязательно нужно устроить себе отдых. Если нельзя взять полноценный отпуск, достаточно нескольких выходных дней. Проведите время в одиночестве или в кругу близких людей. Можно отправиться за город, на природу, в лес или на речку – в зависимости от погодных условий. Займитесь любимым хобби, посетите салон красоты, устройте шоппинг, приготовьте вкусный ужин для своей семьи.

Сон – залог здоровья и слаженной работы половых органов. При стрессе женщине показан здоровый полноценный ночной сон не менее 8 часов. Старайтесь ложиться в постель не позднее 22.00. Проветривайте спальню на ночь. Перед сном примите теплую ванну с пеной, зажгите аромасвечу, послушайте расслабляющую музыку.

Добавьте в свою жизнь больше позитивных эмоций. Встретьтесь со старыми подругами, сходите на свидание, проведите время в окружении детей и животных. Положительный настрой восстанавливает нервные клетки и способствуют успокоению.

Восстановить цикл поможет сбалансированное питание. Диета должна включать в себя свежие овощи и фрукты, белок, полезные сладости для поднятия настроения.

Спорт также поможет вернуться к жизни после перенесенного стресса. Йога, калланетика, плавание, аэробика, медитации помогут научиться держать психическое равновесие и противостоять стрессу и эмоциональным перегрузкам. Для любительниц активного спорта отлично подойдут танцы, легкая атлетика, катание на коньках или лыжах.

Медикаментозное лечение

Ускорить процесс реабилитации после эмоциональных потрясений можно с помощью лекарственных препаратов. Врачи отдают предпочтение растительным медикаментам. Наиболее эффективными считаются:

  • Персен;
  • Афобазол;
  • Ново-Пассит;
  • Тенотен;
  • аптечный настой валерианы или пустырника.

Действие данных препаратов направлено на снижение тревоги и стресса. Они благоприятно влияют на центральную нервную систему, блокируя приступы апатии, беспокойства и раздражения. Применять медикаменты можно только по рекомендации врача, который в зависимости от характера перенесенного стресса назначает дозировку и длительность курса.

Для нормализации цикла пациентке назначаются поливитаминные комплексы. Их прием поможет не только вернуть месячные, но и улучшить состояние кожи, волос и ногтей, а также укрепить здоровье. Для этих целей подойдут Компливит, Магне В6 или Супрадин.

В исключительных случаях врач может прибегнуть к терапии антидепрессантами и психотропными веществами. Данные препараты имеют множество побочных эффектов и назначаются только в случае сильного стресса и затяжной депрессии.

Народные средства

Травяные сборы и отвары на их основе успешно применяются в народной медицине для лечения стресса, усталости, бессонницы или нарушения менструального цикла. Используйте настои из следующих растений:

  • ромашка;
  • мята;
  • зверобой;
  • шалфей;
  • валериана;
  • мелисса;
  • рута;
  • пустырник.

Травы можно отваривать и принимать как по отдельности, так и в виде сбора. Рецепты приготовления для любого сырья одинаковы: 1 ст.л. залить 200 мл воды, прокипятить, дать настояться и пить по несколько глотков перед едой дважды в день.

Рекомендации и профилактика

Для предотвращения сбоев менструального цикла женщине нужно стараться избегать стрессов либо учиться противостоять эмоциональным перегрузкам. Важно заниматься укреплением физического здоровья и иммунитета, особенно в сезон гриппа и ОРВИ.

Питание играет не последнюю роль в формировании женского здоровья. Откажитесь от фаст-фуда, слишком жирных и острых блюд. Предпочтительные способы приготовления пищи – варка, тушение или запекание. Овощи и фрукты необходимо употреблять в свежем виде.

Особое внимание следует уделить распорядку дня. Ложиться спать нужно в одно и то же время. На работе старайтесь делать небольшие перерывы по 5-10 минут каждые 1,5-2 часа. Выходные дни проводите на свежем воздухе – пешие прогулки укрепляют здоровье, успокаивают и повышают настроение.

Врач акушер-гинеколог, репродуктолог, консультант по грудному вскармливанию, окончила ЧГУ им. Ульянова со специализацией гинекология, маммология Подробнее »

Поделитесь с друьями!

Как стресс может влиять на менструальный цикл

Помимо бессонницы, головных болей, беспокойства и депрессии стресс также может повлиять и на стабильность менструального цикла у женщин, что может привести либо к задержке месячных, либо их отсутствию.

“Хорошо известно, что при хроническом стрессе у вас больше шансов увидеть некоторые изменения в менструальном цикле, – говорит Лия Миллхейзер, директор программы женской сексуальной медицины в Stanford Health Care. – При нынешних обстоятельствах, в период пандемии, я получаю письма от пациенток, которые страдают от изменений гормонального фона и, как следствие, сталкиваются с нарушением менструального цикла”.

Хоть эксперты говорят, что временные менструальные изменения, вызванные стрессом, довольно распространены, важно пройти осмотр у врача, особенно если проблемы носят продолжительный характер.

“Ваш менструальный цикл является индикатором здоровья всего тела”, – говорит Шрути Махалингайя, акушер-гинеколог Бостонского медицинского центра.

Что такое “обычный” цикл?

По словам Лии Миллхейзер, нормальная продолжительность менструального цикла может варьироваться и зависеть от индивидуальных особенностей каждой девушки, но обычно она составляет от 21 до 35 дней.

У некоторых людей, по словам Махалингайя, наблюдается небольшая изменчивость от месяца к месяцу, и все, что длится до семи дней, может считаться нормой. У других людей более длительные менструальные циклы, которые сами по себе не представляют проблем, если они стабильны.

“У вас может идти менструация до семи дней, но при этом у вас будут регулярные месячные”, – говорит доктор.

По словам Миллхейзер, врачей больше беспокоит ситуация, когда для женщины характерны нормальные, стабильные периоды, но внезапно у нее начинается менструация каждые шесть недель или три месяца: “Когда есть значительные изменения за пределами этого диапазона нормы, тогда вам нужно поговорить с врачом”.

Как стресс влияет на менструальный цикл?

По словам Лины Натан, акушера-гинеколога UCLA Health, люди могут заметить, что у них задерживаются циклы или появляются кровянистые выделения между менструациями. Эти изменения может спровоцировать эмоциональный стресс, например, пандемия, факторы физического стресса, такие как недавняя потеря веса или увеличение физических нагрузок.

Причина, по которой стресс может изменить менструальный цикл, скорее всего, связана с гормонами. Натан говорит, что стресс вызывает повышение уровня кортизола, что может подавлять выработку гормонов, ответственных за овуляцию и менструацию.

“Когда ваше тело находится в состоянии стресса, это действительно не лучшее время для беременности, поэтому оно отключается”, – объясняет доктор.

В большинстве случаев, если у вас нет менструации, вероятно, у вас не происходит овуляция. Но не воспринимайте нерегулярные месячные как признак того, что у вас нет яйцеклеток или вы не можете забеременеть. Овуляция обычно происходит за две недели до менструации. Махалингайя говорит, что даже если у вас давно не было менструации, всегда есть вероятность овуляции.

“Если у вас нерегулярные периоды, ваши шансы забеременеть могут быть снижены, но я все равно рекомендую предохраняться, если вы не планируете беременность”, – говорит Натан.

Отсроченные или пропущенные месячные также могут быть признаком синдрома поликистозных яичников (СПКЯ), который, по словам Натан, обычно сопровождается другими симптомами, такими как усиленный рост волос на теле. По словам Миллхайзер, на менструальный цикл также могут влиять другие заболевания – щитовидной железы, эндокринные.

Как нормализовать свой цикл?

Всем, кого беспокоит задержка менструации, эксперты рекомендуют сначала исключить беременность, а затем поговорить с вашим лечащим врачом или акушером-гинекологом, чтобы определить другие возможные причины.

В зависимости от того, в чем причина, врач может порекомендовать гормональную терапию для регулирования вашего цикла. Если ваш врач подозревает, что ваш пропущенный или отсроченный цикл связан со стрессом, сосредоточьтесь на снижении уровня кортизола. Натан рекомендует спать не менее шести-восьми часов в сутки, придерживаться здорового питания, заниматься спортом и практиковать медитацию или йогу.

Подписывайтесь на наш Telegram-канал и не пропускайте самые полезные материалы от Beauty HUB!

Читайте также

Стресс как причина нарушения регулярности менструального цикла :: АЦМД

Женская гормональная система, одной из основных функций которой является регуляция менструального цикла, крайне чувствительна к различным стрессовым влияниям. Не удивительно, что на фоне изменений качества жизни в нашей стране, аномальный цикл становится обычным явлением. Мы предлагаем рассмотреть основные симптомы, которые сопровождают менструальные нарушения и обозначить роль стресса как причину их возникновения.

На практике каждый доктор гинеколог не однократно сталкивался с пациентками, принимающими нарушение менструального цикла как норму. Как пример, кровотечение, возникающее в середине цикла часто расценивается пациентками как обычная менструация. Давайте разберем основные симптомы, заметив которые, настоятельно рекомендуется посещение врача:

  • Менструация длится более недели.
  • Менструальный цикл (от первого дня кровотечения до первого дня следующего кровотечения) составляет менее 21 дня или более 35 дней.
  • Обильность кровотечения увеличилась, и время между сменой прокладки или тампона составляет менее 2х часов.
  • Отмечаются сильные, внезапные менструальные боли. Понятно, что большинство женщин, особенно не рожавших, могут ощущать умеренную боль, особенно в первых 3 дня.
  • Менструальноподобное кровотечение в менопаузе.

Причинами возникновения нарушения цикла могут быть дисбаланс половых гормонов, отсутствие овуляции, кистозные изменения яичников, патология щитовидной железы, онкопатология, врачебные вмешательства на матке и ее придатках, а так же изменение гормонального фона вследствие нарушения нервной регуляции, к которым относится эмоциональный и физический стресс.

Хроническое перенапряжение нервной системы, возникающее, как пример, на фоне потери или смены работы, переезда, боязни за жизнь или утраты дорогого человека, депрессивных переживаний о завтрашнем дне — пагубно влияют на гормональную систему женщины, проявляясь нарушением регулярности менструального цикла.

К физическому стрессу, который не менее пагубно влияет на организм, можно отнести агрессивные диеты, резкое снижение или чрезмерный набор веса, изнурительный режим труда и неадекватные физические нагрузки.

Для снижения стрессового напряжения важно придерживаться режима здорового питания, следить за распорядком дня. Позитивно влияют закаливающие процедуры, регулярные, с постепенным ростом нагрузки, занятия спортом. Рекомендовано принимать препараты для укрепления и восстановления нервной системы.

Не следует недооценивать и откладывать визит к специалисту при проявлении вышеперечисленных симптомов нарушения цикла.

В клинике АЦМД-Медокс гинекологи-профессионалы помогут Вам разобраться с «женскими» проблемами, при необходимости проведут обследование (УЗИ, лабораторное обследование) и индивидуально для Вас подберут эффективное лечение.

Помните! Важно на ранних этапах установить первопричину, так как длительные стойкие изменения со стороны гормональной системы женщины могут привести к органическим патологическим изменениям.

Будьте здоровы и прекрасны !

Статью подготовили специалисты гинекологического отделения АЦМД-МЕДОКС

Влияние отсроченной репарации периферических нервов на регенерацию нервов, функцию шванновских клеток и восстановление целевых мышц

PLoS One. 2013; 8 (2): e56484.

,
1
,
1
,
1
,

2
,
1
,
1
,

2
,
1
,

*
и
1
,

*

Самуэль Йонссон

1
Кафедра интегративной медицинской биологии, отделение анатомии, Университет Умео, Умео, Швеция,

Ребекка Виберг

1
Кафедра интегративной медицинской биологии, отделение анатомии, Университет Умео, Умео, Швеция,

Александра М.МакГрат

1
Кафедра интегративной медицинской биологии, отделение анатомии, Университет Умео, Умео, Швеция,

2
Отделение хирургических и периоперационных наук, отделение хирургии кисти и пластической хирургии, Университет Умео, Умео, Швеция,

Новиков Лев Николаевич

1
Кафедра интегративной медицинской биологии, отделение анатомии, Университет Умео, Умео, Швеция,

Микаэль Виберг

1
Кафедра интегративной медицинской биологии, отделение анатомии, Университет Умео, Умео, Швеция,

2
Отделение хирургических и периоперационных наук, отделение хирургии кисти и пластической хирургии, Университет Умео, Умео, Швеция,

Людмила Н.Новикова

1
Кафедра интегративной медицинской биологии, отделение анатомии, Университет Умео, Умео, Швеция,

Пол Дж. Кингэм

1
Кафедра интегративной медицинской биологии, отделение анатомии, Университет Умео, Умео, Швеция,

Томас Х. Гиллингвотер, редактор

1
Кафедра интегративной медицинской биологии, отделение анатомии, Университет Умео, Умео, Швеция,

2
Отделение хирургических и периоперационных наук, отделение хирургии кисти и пластической хирургии, Университет Умео, Умео, Швеция,

Эдинбургский университет, Великобритания,

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Задумал и спроектировал эксперименты: Л. Н. Новиков, Л. Н. Новикова М. В. ПК. Проведены эксперименты: SJ RW AMM PK. Проанализированы данные: SJ RW AMM Л. Н. Новиков, Л. Н. Новикова ПК. Предоставленные реагенты / материалы / инструменты анализа: MW. Написал статью: SJ L. N. Novikov PK.

Поступило 3 августа 2012 г .; Принято 10 января 2013 г.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего указания автора и источника.

Эта статья цитируется в других статьях в PMC.

Abstract

Несмотря на успехи хирургических методов восстановления периферических нервов, функциональное восстановление остается неполным. Время операции является одним из факторов, влияющих на степень выздоровления, но еще не ясно определено, как долго можно переносить отсрочку, прежде чем восстановление станет бесполезным. В этом исследовании крысы подверглись перерезке седалищного нерва перед немедленной (0) или 1, 3 или 6-месячной отсроченной репарацией с помощью нервного трансплантата.Регенерацию мотонейронов спинного мозга через 13 недель после восстановления нерва оценивали с помощью ретроградного мечения. Нервную ткань также брали из проксимальной и дистальной культей и из нервного трансплантата вместе с медиальными икроножными (MG) мышцами. Резкое снижение количества регенерирующих мотонейронов и миелинизированных аксонов в дистальной культе нерва наблюдалось в группах с отсрочкой на 3 и 6 месяцев. После 3-месячной задержки количество аксонов в проксимальной культи увеличилось в 2–3 раза, что сопровождалось уменьшением площади аксонов.ОТ-ПЦР дистальных нервных сегментов выявила снижение маркеров шванновских клеток (SC), особенно в образцах отсроченной репарации через 3 и 6 месяцев. Также наблюдалось прогрессирующее увеличение маркеров фиброза и протеогликановых рубцов в дистальном нерве с увеличением времени отсроченного восстановления. Выход SC, выделенных из дистальных нервных сегментов, прогрессивно падал с увеличением задержки времени восстановления, но культивированные SC из всех групп размножались с одинаковой скоростью. Мышца MG при отсрочке восстановления на 3 и 6 месяцев показали значительное снижение веса (61% и 27% по сравнению с контрлатеральной стороной).Атрофия мышечных волокон и изменения нервно-мышечных соединений наблюдались с увеличением времени отсроченного восстановления, что свидетельствует о прогрессирующем нарушении реиннервации. Это исследование демонстрирует, что одним из основных факторов, ограничивающих регенерацию нерва после отсроченной репарации, является дистальная культя. Критический момент времени, после которого результат регенерации становится слишком плохим, составляет 3 месяца.

Введение

Повреждения периферических нервов (PNI) являются обычным явлением, с ежегодной частотой 300 000 случаев в Европе [1], и, несмотря на успехи в хирургическом лечении, восстановление двигательных и сенсорных функций часто остается неполным.Поскольку средний возраст пациента составляет от 18 до 44 лет, легко понять серьезность этих травм. Помимо инвалидности пациента, огромна экономическая нагрузка как на личном уровне, так и на общество в целом [2].

Несколько факторов, включая тип травмы, возраст пациентов и расстояние от места поражения до тела клетки, могут определять тяжесть повреждения периферического нерва и функциональный результат после восстановления нерва. Пересечение дистального периферического нерва (e.грамм. в седалищном нерве) у новорожденных крыс почти полностью устраняет соответствующие мотонейроны позвоночника в течение 2 недель [3], в то время как тот же тип повреждения у взрослых животных не влияет на выживаемость мотонейронов [4], [5]. Однако более проксимальные повреждения спинномозговых нервов [6], [7] и спинномозговых корешков [8] могут привести к значительной дегенерации вентрального рога спинного мозга. В отличие от моторных клеток, первичные сенсорные нейроны как новорожденных, так и взрослых в ганглиях задних корешков подвергаются клеточной гибели даже после повреждения дистального периферического нерва [5], [9].Утрата сенсорных нейронов, вероятно, будет способствовать плохому восстановлению сенсорной функции, наблюдаемому клинически после поражения периферических нервов [10].

Было показано, что не только длительная аксотомия, но и длительная денервация могут влиять на функциональное восстановление после отсроченной репарации нерва [11], [12]. Поддержание мышечной ткани зависит как от электрической, так и от нейротрофической стимуляции, которые теряются при повреждении нерва. Это приводит к трофическим, механическим и молекулярным изменениям в мышцах.После денервации мышца подвергается прогрессирующей атрофии, скорость и сила сокращения снижаются, и часто наблюдается переход от фенотипа с медленным сокращением к быстро сокращающимся волокнам [13], [14]. Мышечные сателлитные (стволовые) клетки отвечают за рост, восстановление и регенерацию мышечной ткани. После перерезки нерва наблюдается первоначальное увеличение пролиферации сателлитных клеток, что усиливает способность к регенерации недавно денервированной мышцы. Однако, если аксотомия продлится, количество сателлитных клеток в мышечной ткани резко снизится.Таким образом, реиннервация считается решающей для поддержания активности и количества сателлитных клеток [15], [16].

Однако есть клинические случаи, когда есть сомнения в том, что повреждение нерва работоспособно и стоит ли делать операцию, если после травмы произошла задержка во времени. Примером, где это важно, является случай акушерской травмы плечевого сплетения. Даже при использовании современных методов визуализации трудно диагностировать и различать преганглионарные и постганглионарные травмы сплетения, а микрохирургическая реконструкция плечевого сплетения часто выполняется с задержкой в ​​3–6 месяцев [17], что приводит к плохому восстановлению чувствительности и снижению двигательной функции в позвоночнике. пораженная конечность [18].Задержка хирургического вмешательства также является хорошо известным фактором, существенно влияющим на прогноз после повреждений срединного и локтевого нервов [19]. Хотя было показано, что раннее хирургическое вмешательство полезно как для моторного, так и для сенсорного восстановления [20] — [22], нет окончательных клинических рекомендаций относительно временной задержки, когда уже слишком поздно выполнять восстановление нерва. Повреждение периферического нерва часто связано со значительной потерей нервной ткани, вызывающей длинные нервные промежутки и требующей пересадки нерва для воссоединения разделенных культи нервов [10], [23].Последнее состояние является еще одной причиной плохого восстановления функции после микрохирургической пластики поврежденных нервов [1].

Целью данного исследования является использование клинически значимой экспериментальной модели на животных с длительной аксотомией и денервацией с последующей отсроченной трансплантацией периферических нервов, чтобы определить, когда регенеративная способность поврежденных нейронов становится неприемлемо низкой при задержке восстановления, и выявить механизмы, опосредующие плохую работу. регенерация аксонов и восстановление мышц.

Материалы и методы

Экспериментальные животные и заявление об этике

Взрослые (8–10-недельные) инбредные крысы Fisher F344 (Scanbur BK AB, Швеция) использовались на протяжении всего исследования. Животноводство соответствовало стандартам и правилам, установленным Руководством по уходу и использованию лабораторных животных Национального института здравоохранения (Публикации NIH № 86–23, пересмотренный 1985 г.) и Директивой Совета Европейских сообществ (86/609 / EEC). ). Все процедуры были одобрены Северным шведским региональным комитетом по этике экспериментов на животных.Операцию проводили в асептических условиях под общей анестезией с использованием смеси кетамина (Ketalar 50 мг / мл Pfizer, Швеция) и ксилазина (Rompun 20 мг / мл Bayer Health Care, Германия) путем внутрибрюшинной инъекции. Бензилпенициллин (Boehringer Ingelheim; 60 мг) вводили после операции. На протяжении всего экспериментального периода наблюдали за крысами и их самочувствием. В конце периода выживания крысам окончательно вводили внутрибрюшинную передозировку пентобарбитала натрия (240 мг / кг, Апотексболагет, Швеция).

Экспериментальные группы

Было использовано повреждение седалищного нерва (см. Ниже), и крысы были разделены на пять групп для оценки регенерации аксонов, изменений в культе дистального нерва и восстановления мышц и реиннервации сразу после (n = 5) или отсроченный ремонт через 1 месяц (n = 5), 3 месяца (n = 5) и 6 месяцев (n = 4). Отдельную серию животных использовали для экспериментов по ретроградному мечению.

Покрытие нерва и отсроченное восстановление

Седалищный нерв обнажили путем прямого разделения ягодичных мышц бедра.Нерв был рассечен на стандартном расстоянии от спинного мозга на уровне верхней границы бедренной мышцы квадранта. В экспериментальных группах с отсроченным восстановлением нерва обрубки нерва были перевязаны примерно на 1 мм от отрезанного конца с использованием нерассасывающейся нити Ethilon 8–0 для предотвращения реиннервации. Колпачки делались из полиэтиленовых трубок. Каждую культю вводили и прикрепляли к нижней части колпачка с помощью шовного материала 8–0 Ethilon [24]. Проксимальную культю поместили под четверную мышцу бедренной кости, а дистальную культю — в подколенную ямку.Рана ушита послойно; на мышцы наложите рассасывающийся шов Викрил 6–0, а на кожу — наложите шовный материал 3–0 шелк. Через 1, 3 или 6 месяцев, восстановление нерва выполняли под операционным микроскопом (Zeiss, Carl Zeiss, Германия) с использованием микроинструментов и нерассасывающейся нити Ethilon 10–0 [5]. Проксимальную и дистальную культю седалищного нерва повторно обнажили, обрезали на 2–3 мм для удаления невромы / рубцовой ткани и восстановили с помощью 10-миллиметрового трансплантата обратного седалищного нерва от донорской крысы Fisher. Трансплантат фиксировали четырьмя узловыми эпиневриальными швами, выровненными по окружности в каждом анастомозе, и рану закрывали послойно.В экспериментальной группе с немедленным восстановлением нерва культи нерва были перекрыты 10-миллиметровым обратным седалищным аутотрансплантатом.

Ретроградное мечение мотонейронов спинного мозга

Ретроградное мечение мотонейронов позвоночника, регенерирующих в дистальную культи нерва, проводили через 12 недель после пересадки нерва. Седалищный нерв рассекали в подколенной ямке на расстоянии 10 мм от места восстановления и вводили в небольшую полиэтиленовую трубку, содержащую два микролитра флуоресцентного индикатора Fluoro-Ruby (FR, 10% раствор в физиологическом растворе, Invitrogen, Швеция).Трубку прикрепляли к окружающим мышцам с помощью клея Histoacryl® (Braun Surgical GmbH, Германия) и герметизировали смесью силиконовой смазки и вазелина для предотвращения утечки. Через два часа чашку удалили, нерв промыли физиологическим раствором и рану послойно закрыли. Перед забором тканей животных оставляли выживать в течение одной недели.

Обработка тканей

После немедленной и отсроченной репарации нервов всем животным позволяли выжить еще 13 недель, прежде чем им была введена передозировка пентобарбитала натрия (240 мг / кг, Apoteksbolaget, Швеция).Седалищный нерв полностью удалили, а затем отрезали три куска нерва диаметром 3 мм; 5 мм от проксимального анастомоза, в середине нервного трансплантата и 5 мм от дистального анастомоза. Нервные сегменты фиксировали в 3% глутаровом альдегиде, затем фиксировали в 1% тетроксиде осмия (OsO4) в 0,1 М какодилатном буфере (pHZ7,4), обезвоживали в ацетоне и заключали в Вестопал. Каждый оставшийся 5-миллиметровый нервный сегмент непосредственно проксимальнее или дистальнее границы раздела нервного трансплантата был разделен пополам и одну часть использовали для культур шванновских клеток in vitro или мгновенно заморозили в жидком азоте для последующего анализа RT-PCR.Медиальные икроножные мышцы собирали, взвешивали и быстро замораживали в жидком азоте. Другим животным, меченным фтор-рубином, проводили транскардиальную перфузию раствором Тирода (37 ° C), а затем 4% (мас. / Об.) Параформальдегидом (PFA, pH 7,4). Сегменты спинного мозга L4 – L6 собирали и фиксировали в 4% PFA в течение ночи. Сегменты спинного мозга вырезали на серийные парасагиттальные срезы толщиной 50 мкм на вибратоме (Leica Instruments, Германия), устанавливали на предметные стекла, покрытые желатином, и покрывали срезы DPX.

Подсчет нейронов

Ядерные профили меченых мотонейронов подсчитывали во всех срезах при увеличении × 250 под флуоресцентным микроскопом Leitz Aristoplan с использованием блока фильтров N2.1. Общее количество ядерных профилей не корректировалось для расщепленных ядер, поскольку диаметры ядер были малы по сравнению с используемой толщиной сечения. Ранее мы продемонстрировали, что точность этого метода в оценке ретроградной гибели клеток в спинном мозге аналогична точности, полученной с помощью метода физического диссектора [7] и подсчета нейронов, реконструированных из серийных срезов [4].Препараты фотографировали цифровым фотоаппаратом Nikon DXM1200. Размер захваченных изображений был изменен, они сгруппированы в единый холст и помечены с помощью программного обеспечения Adobe Photoshop CS4. Контрастность и яркость были отрегулированы для обеспечения оптимальной четкости.

Подсчет аксонов и оценка площади

Полутонкие поперечные срезы проксимального, среднего трансплантата и дистального нервных сегментов вырезали на ультратоме 2128 (LKB, Швеция) и окрашивали толуидиновым синим. Миелинизированные аксоны в проксимальных и дистальных обрубках нерва и в середине нервного трансплантата подсчитывали при конечном увеличении × 1000 с использованием зонда фракционирования в программном обеспечении Stereo Investigator ™ 6 (MicroBrightField, Inc.,США). Площадь аксонов рассчитывалась с помощью программного обеспечения после ручной маркировки внешней границы одиночных аксонов. Затем площадь описывалась как среднее значение после измерения и суммирования площади 30 аксонов в четырех случайных участках на поперечное сечение и деления общей площади на количество подсчитанных аксонов.

ОТ-ПЦР

Общую РНК выделяли из дистальных нервных сегментов и мышц с использованием набора RNeasy ™ (Qiagen, Швеция), а затем 1 нг РНК включали в набор для одностадийной ОТ-ПЦР (Qiagen) на реакционную смесь.Использовали термоциклер (Biometra, Германия) со следующими параметрами: этап обратной транскрипции (50 ° C, 30 мин), этап денатурации нуклеиновой кислоты / инактивации обратной транскриптазы (95 ° C, 15 мин) с последующими 35 циклами денатурации. (95 ° C, 30 секунд), отжиг (30 секунд) и удлинение праймера (72 ° C, 1 мин) с последующей инкубацией окончательного удлинения (72 ° C, 5 минут). Прямые и обратные праймеры (все 5 ‘→ 3’) пары (Sigma-Aldrich, Великобритания) с используемыми температурами отжига описаны в. ПЦР-ампликоны подвергали электрофорезу (50 В, 90 мин) через 1.5% (мас. / Об.) Агарозный гель и размер продуктов ПЦР оценивали с помощью Hyperladder IV (Bioline, UK). Образцы визуализировали при УФ-освещении после окрашивания нуклеиновой кислотой GelRed ™ (Bio Nuclear, Швеция) встраивания в агарозу.

Таблица 1

Последовательности праймеров для RT-PCR и температуры отжига (° C).

Фактор Прямой праймер (5 ‘→ 3’) Обратный праймер (5 ‘→ 3’) ° C
S100B GTTGCCCTCATTGATGTCTTC AGACGAAGGCCATAAACTCCT 57.9
erbB2 AACCTTTCCTTGCTGCTTGA GTTCCCTCCAGACCTCTTCC 59,9
erbB3 AGAGGCTTGTCTGGATTCT AGGAGTAAGCAGGCTGTGT 55,9
erbB4 AACCAGCACCATACCAGAGG TTCATCCAGTTCTGCTCGTG 62,1
TGF-β CTAATGGTGGACCGCAACAAC CGGTTCATGTCATGGATGGTG 67.8
тенасцин C GCCTCAACAACTGCTACAATCGTG TCAGCCCCTGTGAACCCATC 66,1
коллаген I GTGAACCTGGCAAACAAGGT CTGGAGACCAGAGAAGCCAC 64,1
фосфакан GAATTCTGGTCCACCAGCAG GGTTTATACTGCCCTCTTTAGG 59,0
версия ACACAGGGAGAAACCCAGGA TGTCTTGTTTTCTCTGACCT 61.0
α-наЧР TGTGTCTCATCGGGACGC GGGCAGAGGGAGGCTTAGTTC 64,0
β-наЧР CCGTGTCACTGCTGAATCTGT CTCAAAGGACACCACGACAT 60,9
γ-наЧР TGTCATCAACATCATCGTCCC CGAGGAAAAGGAAGACGGT 61,8
δ-нАЧР TGTGGAGAGAAGACCTCG AGCCTCTTGGAGATAAGCAAC 57.0
е-наЧР AACTGTCTGACTGGGTGCGT GAAGATGAGCGTAGAACCGAC 61,8
МУСК TGAAGCTGGAAGTGGAGGTTTT GCAGCGTAGGGTTACAAAGGAA 63,3
18S TCAACTTTCGATGGTAGTCGC CCTCCAATGGATCCTCGTTAA 62,1
актин ACTATCGGCAATGAGCGGTTC AGAGCCACCAATCCACACAGA 64.1

Культура шванновских клеток (SC)

Под препарирующей микросопой удаляли эпиневрий из проксимального и дистального нервных сегментов. Далее нервы делили на кусочки 0,5–1 мм и помещали в чашку Петри, содержащую среду для роста клеток Шванна [(среда Игла, модифицированная Дульбекко (DMEM), содержащая 10% (об. / Об.) Фетальной телячьей сыворотки (FCS) и 1% (об.)). / v) раствор пенциллина / стрептомицина (все от Invitrogen) с добавлением 10 мкМ форсколина (Sigma) и нейрегулина NRG1 (R&D Systems, Великобритания)].Нервы инкубировали в течение 2 недель перед добавлением 0,0625% (мас. / Об.) Коллагеназы типа 4 (Worthington Biochemicals, США) и 0,585 Ед / мг диспазы (Invitrogen) в течение 24 часов. Нервы растирали, фильтровали через сетчатый фильтр для клеток 70 мкм и центрифугировали при 800 об / мин в течение 5 мин. Осадок ресуспендировали в 5 мл питательной среды SC и высевали в 25 см колбу 2 . Клетки оставляли инкубироваться при 37 ° C / 5% CO 2 в течение 7 дней, а затем обрабатывали трипсином и подсчитывали количество клеток после отделения загрязняющих фибробластов с использованием магнитных шариков, связанных с антифибробластными антителами, в соответствии с инструкциями производителя (Miltenyi Biotech , Германия).При пассаже 2 шванновские клетки высевали с плотностью 7500 на лунку в 24-луночный планшет и оценивали на пролиферацию в течение 5 дней с использованием анализа Alamar Blue, как описано ранее [25]. Тотальную РНК также выделяли из культур шванновских клеток при пассаже 2 и проводили ОТ-ПЦР с использованием праймеров, описанных в.

Совместное культивирование шванновских клеток и нейронов

Шванновские клетки (4 × 10 4 клеток, пассаж 2) высевали на предметные стекла с 8-луночной камерой и оставляли для осаждения в течение 1 дня перед добавлением 2 × 10 3 NG108 -15 клеток (линия нейрональных клеток, моделирующих двигательные нейроны).Два типа клеток совместно культивировали в течение 48 часов, а затем фиксировали 4% (мас. / Об.) PFA. Флуоресцентная иммуноцитохимия использовалась для визуализации роста нейритов NG108-15. Вкратце, фиксатор удаляли, а клетки промывали PBS и повышали проницаемость с использованием 0,1% (об. / Об.) Triton X-100 в течение 15 мин в присутствии 5% (об. / Об.) Агента, блокирующего нормальную сыворотку. Затем клетки инкубировали с моноклональным антителом к ​​βIII-тубулину (разведение 1/500; Sigma, Poole UK) в течение 2 часов при комнатной температуре. После промывок PBS слайды подвергали воздействию вторичных козьих антител против мыши Alexa Fluor 488 (1-1000) в течение 1 часа в темноте.После двух заключительных промывок в PBS на предметные стекла помещали среду для фиксации против выцветания Prolong, содержащую 4′-6-диамидино-2-фенилиндол (DAPI). Слайды были сфотографированы цифровой камерой Nikon DXM1200, присоединенной к микроскопу Leitz, и в среднем 150 клеточных тел NG108-15 для каждого состояния были проанализированы (n = 4 повтора) на рост нейритов с использованием программного обеспечения Image-Pro Plus (MediaCybernetics, UK). . Нейриты регистрировали с помощью функции трассировки. Рассчитывали среднее количество нейритов на нейрон и среднюю длину нейрита вместе со средней длиной самого длинного нейрита.

Анализ мышц

Шестнадцать микронных поперечных срезов икроножных мышц с контрлатеральной и оперированной сторон вырезали на криостате, фиксировали 4% (мас. / Об.) PFA в течение 15 минут и затем блокировали нормальной сывороткой. Затем срезы инкубировали с моноклональными первичными антителами, индуцированными против быстрого и медленного белка тяжелой цепи миозина (NCL-MHCf и NCL-MHCs, Novocastra, Великобритания, оба разведения 1-20) в течение 2 часов при комнатной температуре. Каждое предметное стекло также совместно инкубировали с кроличьими антителами против ламинина (Sigma; разведение 1-200).После промывания в фосфатно-буферном растворе вторичные козьи антикроличьи и козьи антимышиные антитела Alexa Fluor 488 и Alexa Fluor 568 (1∶200; Invitrogen) наносили на 1 ч при комнатной температуре в темноте. Слайды покрывали защитной средой Prolong, препятствующей выцветанию, содержащей DAPI. Специфичность окрашивания подтверждена отсутствием первичных антител. Препараты фотографировали цифровой камерой Nikon DXM1200, присоединенной к микроскопу Leitz. Морфометрический анализ мышечных срезов проводился на закодированных слайдах без знания их источника.Были выбраны пять случайных полей (с использованием объектива × 16), и изображения для иммунолокализации каждого типа тяжелой цепи миозина и ламинина были захвачены с использованием соответствующих фильтров излучения и объединены для получения изображений с двойной меткой. Каждое изображение содержало не менее 25 отдельных мышечных волокон для анализа. Программное обеспечение Image-Pro Plus было откалибровано для расчета средней площади и диаметра (в мкм) для каждой мышцы. Травмированную сторону выражали относительно контрлатеральной контрольной стороны, и для каждой группы рассчитывали относительное среднее значение% ± SEM.

Для окрашивания нервно-мышечных соединений антитело против пресинаптического маркера SV2A использовали вместе с альфа-бунгаротоксином (α-BTX) для окрашивания постсинаптических рецепторов ацетилхолина (AChR). Срезы мышц фиксировали и блокировали сывороткой, как указано выше, а затем инкубировали с поликлональным анти-кроличьим SV2A (1-50, Abcam, Великобритания) в течение 2 часов при комнатной температуре. После промывки слайды инкубировали в течение 1 ч в темноте с вторичным антителом Alexa Fluor 568 козьим антикроличьим IgG (1 × 100, Invitrogen) и α-бунгаротоксином-FITC (1 × 10, Sigma).После промывки PBS на предметные стекла помещали реагент Prolong и срезы исследовали под флуоресцентным микроскопом.

Статистический анализ

Для определения статистической разницы между группами использовали односторонний дисперсионный анализ (ANOVA), дополненный тестом Ньюмана-Кеулса (программное обеспечение Prism Graph-Pad). Статистическая значимость была установлена ​​как * p <0,05, ** p <0,01, *** p <0,001.

Результаты

Регенерация мотонейронов позвоночника, число аксонов и площадь

Животным была проведена перерезка седалищного нерва с последующим немедленным или отсроченным восстановлением (через 1, 3 или 6 месяцев) с использованием нервных трансплантатов 10 мм, а затем через 13 недель мотонейрона регенерация была проанализирована.Сегменты нерва были также удалены в проксимальной, средней и дистальной областях трансплантата и проанализированы с помощью световой микроскопии на морфометрию аксонов. Спинальные мотонейроны, которые регенерировали свои аксоны через нервный трансплантат, были идентифицированы и подсчитаны после мечения флуоресцентным красителем Fluoro-Ruby (). После немедленной репарации нерва или отсроченной репарации в течение 1 месяца 1027 ± 31 и 1041 ± 26 мотонейронов регенерировали в дистальную культю нерва (). Напротив, отсроченная пересадка нервов на 3 и 6 месяцев резко снизила количество регенерирующих спинномозговых мотонейронов до 374 ± 34 и 253 ± 19 соответственно ().Проксимальная культя нервов от животных, подвергшихся немедленной репарации, показала аксоны большого диаметра, а срезы от животных с отсроченным восстановлением в течение 1 месяца выглядели аналогичными (). Напротив, участки отсроченной репарации через 3 и 6 месяцев показали большее количество аксонов меньшего размера (). На дистальных культях наблюдалось прогрессирующее снижение количества аксонов от немедленного восстановления до 6-месячной задержки восстановления у животных (). Срезы от средней точки трансплантата выглядели одинаковыми во всех временных точках ().Эти наблюдения были количественно определены с помощью программного обеспечения Stereo Investigator (). Число аксонов в середине трансплантата не показало значимой разницы между любой из групп. В проксимальном сегменте не наблюдалось разницы в количестве аксонов между группами немедленного восстановления и 1-месячной группой. Однако через 3 и 6 месяцев количество аксонов значительно увеличилось в 2–3 раза (). В дистальном сегменте количество аксонов показало минимальное снижение после 1 месяца отсроченного восстановления по сравнению с немедленным восстановлением.Однако к 3-месячной отсрочке количество дистальных аксонов было значительно снижено примерно на 80–90% по сравнению как с немедленным восстановлением, так и с 1-месячной группой (). Число аксонов было дополнительно статистически снижено между 3- и 6-месячными группами.

Меченные фтор-рубином мотонейроны через 13 недель после немедленного восстановления нерва (A), через 1 месяц отсроченного восстановления (B), через 3 месяца отсроченного восстановления (C) и через 6 месяцев отсроченного восстановления (D).

Обратите внимание на значительное уменьшение количества регенерирующих мотонейронов после 3 и 6 месяцев отсроченного восстановления нерва.Масштабная линейка = 100 мкм. (E) Гистограмма, показывающая количественную оценку среднего числа ± SEM регенерирующих спинномозговых мотонейронов после 0-6 месяцев (мес) отсроченной репарации. n = 5, * p <0,05 (3 мес. по сравнению с 6 мес.), *** p <0,001 (0 мес. и 1 мес. по сравнению с 3 мес. и 6 мес.).

Миелинизированные аксоны, окрашенные толуидиновым синим, в проксимальных культях, в средней части трансплантата и дистальных культях животных, перенесших повреждение седалищного нерва с последующим немедленным или отсроченным восстановлением нерва (в указанные моменты времени) с 10

мм привой. Обратите внимание на увеличение количества мелких миелинизированных волокон в проксимальной культи в группах 3 и 6 месяцев. Шкала шкалы = 30 мкм.

Количественный анализ (A) числа миелинизированных аксонов и (B) аксональной области в проксимальных культях, областях среднего трансплантата и дистальных культях животных, перенесших повреждение седалищного нерва с последующим немедленным или отсроченным восстановлением нерва (в указанные моменты времени ) с 10

мм привой. Показанные значения являются средними ± стандартная ошибка среднего, n = 5, *** p <0,001 значительно отличается от соответствующей области после немедленного восстановления нерва.

Площадь аксонов в дистальной культи не показала статистической разницы между любыми группами (). В середине трансплантата наблюдалось небольшое уменьшение площади аксонов в группах с отсрочкой на 3 и 6 месяцев по сравнению с группами немедленной и 1-месячной отсроченной репарации. Наиболее интересно то, что проксимальная культя показала прогрессивное и статистически значимое уменьшение аксональной площади через 3 и 6 месяцев отсроченной репарации ().

Анализ культи дистального нерва

Чтобы оценить молекулярный состав культи дистального нерва после немедленной или отсроченной репарации нерва, из нервной ткани была выделена РНК и проведена ОТ-ПЦР ().По сравнению с группами немедленной репарации и группы с отсрочкой восстановления через 1 месяц было заметное снижение мРНК S100B (маркер шванновских клеток) в группах с отсрочкой репарации через 3 и 6 месяцев. Также определяли уровни рецепторов нейрегулина / глиального фактора роста erbB2-4. Не было видимых изменений в экспрессии erbB2 в различных экспериментальных условиях. Напротив, наблюдалось умеренное снижение уровня erbB3 и значительное снижение уровней мРНК erbB4 в дистальных отделах культей животных, подвергшихся отложенной репарации через 3 и 6 месяцев ().Также оценивали ряд молекул, связанных с фиброзом и рубцом. Трансформирующий фактор роста бета (TGF-β) едва обнаруживался в группах немедленной репарации, но его регуляция постепенно повышалась с увеличением времени отсроченной репарации. Точно так же экспрессия тенасцина С наблюдалась только у животных с отсроченным восстановлением через 3 и 6 месяцев (). МРНК коллагена I экспрессировалась во всех дистальных культях, как и протеогликан версикан внеклеточного матрикса. Другой хондроитинсульфат протеогликан (CSPG), фосфакан, был значительно повышен только в группе отложенной репарации через 6 месяцев ().

Качественный анализ ОТ-ПЦР различных шванновских клеток, аксонов и молекул, ассоциированных с фиброзом / рубцом, в проксимальных культях, средних участках трансплантата и дистальных культях животных, перенесших повреждение седалищного нерва с последующим немедленным или отсроченным восстановлением нерва (в указанные временные точки) с 10

мм привой. 18 S используется в качестве домашнего гена.

Анализ шванновских клеток

Шванновские клетки выделяли из проксимальных и дистальных культей нерва и размножали in vitro ().Во всех экспериментальных группах стабильное количество шванновских клеток можно было выделить из проксимальных культей (). Напротив, при более длительной задержке восстановления нерва наблюдалось прогрессивное уменьшение количества шванновских клеток, которые можно было выделить из дистальных культей (). Это уменьшение количества клеток Шванна сопровождалось увеличением количества контаминирующих фибробластов. Чтобы определить, являются ли эти изменения результатом снижения чувствительности к факторам роста глии, был проведен анализ пролиферации ().При культивировании в присутствии форсколина и нейрегулина не было значительных различий в скорости роста шванновских клеток, выделенных из дистальных культей животных, подвергшихся немедленной или отсроченной репарации нервов. Кроме того, клетки этих животных росли аналогично клеткам, выделенным от контрольных неповрежденных крыс. В соответствии с этими наблюдениями уровни экспрессии рецепторов erbB были сходными в шванновских клетках, выделенных из всех групп (). Затем мы определили, сохраняют ли шванновские клетки, выделенные из дистальных культей, нейротрофические свойства.Мы использовали нашу ранее опубликованную модель, в которой клетки NG108-15 (модельная линия клеток двигательного нейрона) совместно культивируются на монослое шванновских клеток [25]. Клетки Шванна, выделенные из неповрежденного контрольного нерва, значительно усиливали рост нейритов из клеток NG108-15 (). Клетки Шванна, полученные от животных, подвергшихся немедленному или замедленному восстановлению нервов, также значительно усиливали рост нейритов, и не было статистически значимых различий между группами ().

Характеристика шванновских клеток, выделенных из нервных сегментов.

(A) Количество шванновских клеток из проксимальных и дистальных обрубков нерва животных, перенесших повреждение седалищного нерва с последующим немедленным или отсроченным восстановлением нерва (в указанные моменты времени) с 10-миллиметровым трансплантатом, подсчитывали через 7 дней после ферментативного переваривания нерв. Подсчет фибробластов также производился после обработки образцов магнитными антифибробластными гранулами. (B) Шванновские клетки дистального сегмента нерва из (A) были трипсинизированы и повторно посажены, и скорости пролиферации (в присутствии факторов роста глии) сравнивались с контрольными нормальными культурами шванновских клеток (без экспериментального повреждения или восстановления).(C) Качественный анализ RT-PCR маркера шванновских клеток S100 и уровней экспрессии рецепторов глиального фактора роста erbB2 и erbB3 в культивируемых клетках, выделенных из контрольного нерва (без экспериментального повреждения или восстановления) и дистальных нервных сегментов животных, подвергшихся немедленной (0 месяцев) ) или отсроченное восстановление нерва (1, 3, 6 месяцев). Актин использовался как ген домашнего хозяйства.

Совместное культивирование шванновских клеток с нейронами NG108-15.

(A) Клетки NG108-15 выращивали отдельно или поверх монослоя шванновских клеток, выделенных из контрольного нерва или дистальных нервных сегментов, взятых у животных, подвергшихся немедленному (0) или 6-месячному отсроченному восстановлению нерва (6).Культуры окрашивали антителом к ​​тубулину βIII (зеленый) и DAPI (синий). (B) Количественный анализ роста нейритов был проведен на нейронах NG108-15, выращенных в отсутствие (контроль) или в присутствии шванновских клеток, выделенных из контрольного нерва (+ SC) или дистальных нервных сегментов от животных, подвергшихся восстановлению нерва сразу после повреждения (0) или отсроченный ремонт на 1, 3, 6 мес. *** P <0,001 значительно отличается от значений в отсутствие клеток Шванна. Не было значительного различия между культурами в присутствии шванновских клеток.

Анализ мышц

Медиальные икроножные мышцы с контрлатеральной и оперированной сторон были разделены и окрашены антителами, направленными против белка тяжелой цепи миозина быстрого и медленного типов (). Контрабоковые мышцы показали хорошо организованную структуру, преимущественно населенную мышечными волокнами быстрого типа. Мышца на прооперированной стороне животных, подвергшихся немедленному восстановлению, также имели нормальную морфологию мышц, но были признаки группировки медленных мышечных волокон ().Напротив, образцы мышц, взятые у животных, подвергшихся восстановлению нервов после 6-месячной задержки, показали неправильную морфологию и явное уменьшение размера мышечных волокон (). Был проведен количественный анализ размера мышечных волокон (), который показал значительное уменьшение площади волокон быстрого типа с отсроченным восстановлением на 1 месяц и прогрессивно уменьшающимся размером волокон у животных с отсроченным восстановлением через 3 и 6 месяцев (). Размер волокон медленного типа не был значительно уменьшен до 6 месяцев отсрочки ремонта.Аналогичные данные были получены при измерении диаметров волокон (). Животные с немедленным восстановлением нерва или с задержкой в ​​1 месяц показали примерно 20% снижение сырого веса оперированных боковых мышц по сравнению с контрлатеральной стороной (). В соответствии с уменьшением размера мышечных волокон произошло значительное снижение сырого веса мышц, собранных в группах отсроченного восстановления через 3 и 6 месяцев ().

Морфология волокон икроножных мышц быстрого и медленного типа.

(A) Поперечные срезы контрлатеральных и оперированных боковых мышц окрашивали антителом к ​​ламинину (зеленый) и антителом к ​​белку тяжелой цепи миозина быстрого или медленного типа (красный). Показаны образцы от животных, подвергшихся немедленному ремонту (0 месяцев) или отложенному ремонту (6 месяцев). Масштабная линейка = 100 мкм.

Количественная оценка размера мышечных волокон и веса мышц.

Компьютерный анализ изображений был использован для расчета среднего ± SEM площади (A) и диаметра (B) волокон быстрого и медленного типов в мышцах, полученных с контрлатеральной и оперированной сторон животных через 3 месяца после восстановления.Данные выражены в процентах от контралатеральной стороны, * P <0,05, ** P <0,01, *** P <0,001 значительно отличается от соответствующих значений у животных, подвергшихся немедленному восстановлению нерва (0 месяцев). (C) Во время сбора урожая были взвешены контрлатеральные и оперированные боковые мышцы. Данные выражены в процентах от веса контрлатеральной стороны, *** P <0,001 значительно отличается от веса после немедленного восстановления нерва (0 месяцев).

Мышцы также исследовали иммуногистохимически () с использованием пресинаптического маркера SV2A и α-бунгаротоксина (α-BTX) для мечения постсинаптических рецепторов ацетилхолина (AChR).Иммуноокрашивание SV2A совпадало с сайтами связывания α-BTX в контрольных мышцах. Нам удалось обнаружить аналогичные структуры нервно-мышечного соединения (НМС) у животных, подвергшихся отсроченному восстановлению через 1, 3 и 6 месяцев; однако в более поздние моменты времени НСС были заметно реже. Кроме того, качественно НМС казались меньше по размеру с увеличением задержки восстановления нерва. Известно, что изменения размера моторной концевой пластинки и количества НМС отражаются в измененных уровнях экспрессии генов, обычно связанных с образованием AChR.Чтобы полуколичественно измерить различия в НМС, мы сравнили уровни транскриптов никотиновых субъединиц AChR (α, β, γ, δ и ε) в мышцах после немедленного и отсроченного восстановления нерва. Были дифференциальные изменения в экспрессии различных субъединиц по сравнению с контрольной мышцей (). Особо следует отметить обнаружение эмбриональной специфической субъединицы γ в мышцах животных, перенесших 3- и 6-месячную отсроченную репарацию нерва. Рецепторная тирозинкиназа, MuSK, внутренний белок NMJ, регулируется состоянием иннервации мышцы.Мы обнаружили, что экспрессия гена MuSK прогрессивно увеличивалась с увеличением времени задержки восстановления (). Эти результаты также предполагают, что реиннервация мышцы после длительного отсроченного восстановления нерва является плохой.

Нервно-мышечные соединения и экспрессия никотиновых рецепторов ацетилхолина (nAChR).

(A) Мышечные срезы окрашивали на nAChR с помощью α-бунгаротоксина-FITC (зеленый) и антитела SV2A (красный) для маркировки пресинаптических структур. Обратите внимание на совпадающее окрашивание обоих маркеров, указывающее на предполагаемые функциональные НМС.Окрашивание DAPI (синий) показывает ядра. Масштабная линейка = 25 мкм. (B) RT-PCR анализ различных субъединиц nAChR (α, β, γ, δ, ε) и мышечно-специфической киназы MuSK в контрольной мышце (con) и мышце с оперированной стороны животных, подвергнутых немедленной (0) или 1, 3,6 месяца отсроченное восстановление нерва. 18 S использовался в качестве домашнего гена.

Обсуждение

Наше исследование ясно демонстрирует, что одним из основных ограничивающих факторов для целевой реиннервации и восстановления после отсроченной репарации является дегенерация дистальной культи, приводящая к гибели шванновских клеток и фиброзу.Во всех группах в середине трансплантата присутствует равное количество аксонов. Однако количество регенерирующих спинномозговых мотонейронов и миелинизированных аксонов, выступающих в дистальную культю, неуклонно снижается, когда восстановление откладывается более чем на один месяц. Это приводит к нарушению реиннервации мышц и усилению атрофии.

В предыдущей работе Гордона и его коллег была предпринята попытка проанализировать факторы, способствующие плохому восстановлению после отсроченной репарации нерва. Роль хронической аксотомии [11] или хронической денервации [12] изучалась независимо.В первом исследовании хронически подвергнутый аксотомии большеберцовый нерв использовался для реиннервации недавно денервированной передней большеберцовой мышцы. Было обнаружено, что длительная аксотомия снижает способность моторных аксонов к регенерации, но не приводит к значительному снижению количества мышечных волокон, иннервируемых каждым аксоном [11]. Во втором исследовании мышца была денервирована путем перерезания общего малоберцового нерва перед отсроченным восстановлением с помощью недавно разрезанного большеберцового нерва, пришитого к дистальной культи. Было обнаружено, что все меньшее количество аксонов реиннервирует мышцу с длительной денервацией, и это объясняется ухудшением внутримышечных оболочек нервов [12].Недавно были опубликованы еще два исследования, в которых изучается эффект отсроченного восстановления, которые показывают противоречивые результаты. Kou et al. Показали, что регенерация через 8-недельный денервированный дистальный нерв значительно нарушена по сравнению с ранним восстановлением [26]. Однако Rönkkö et al. Показали, что не было различий в количестве отростков аксонов в дистальной культе нерва между периодами денервации от двух до шести месяцев [27].

В настоящем исследовании мы использовали клинически значимую модель отсроченного восстановления нерва, которая позволила нам проанализировать комбинированные эффекты длительной аксотомии и денервации дистальной культи нерва.Количество аксонов в проксимальной и дистальной культи нерва было примерно одинаковым после немедленного или отсроченного восстановления нерва через 1 месяц. Однако в нервном трансплантате было подсчитано повышенное количество аксонов, указывающих на прорастание, и это число было одинаковым для всех исследованных временных точек. Механизм прорастания в середине трансплантата периферического нерва неясен. Более того, мы сообщали ранее, что только около половины спинномозговых мотонейронов и сенсорных нейронов ганглия задних корешков (DRG) способны посылать свои аксоны из проксимальной культи нерва в дистальную культи нервного трансплантата [5], [6].

Кроме того, мы обнаружили усиленное разрастание аксонов в проксимальной культи после длительной отсроченной репарации. Это наблюдалось ранее, но не было сделано четких выводов [28]. Ранее мы показали, что после 13 недель хронической седалищной аксотомии только кожные сенсорные нейроны DRG претерпевают значительную ретроградную гибель клеток, в то время как количество сенсорных нейронов DRG, проецируемых в мышцы и спинномозговые мотонейроны, остается в значительной степени неизменным [5]. Однако более проксимальные повреждения нерва могут вызывать ретроградную дегенерацию мотонейронов спинного мозга [6], [29].Таким образом, мы предполагаем, что пространства проксимальной культи, которые раньше были заняты аксонами, происходящими от кожных сенсорных нейронов, были заменены отростками спинных мотонейронов и мышечных сенсорных нейронов DRG. Это коррелирует с обнаружением большего количества аксонов с меньшим средним диаметром проксимальной культи.

Наиболее поразительным результатом было значительное снижение количества регенерирующих спинномозговых мотонейронов и миелинизированных аксонов, обнаруженных в дистальной культи после 3 и 6 месяцев задержки восстановления нерва.Мы использовали только что собранный нервный трансплантат для восстановления травмы и обнаружили, что он поддерживает рост и прорастание аналогичного количества аксонов во все временные точки. Наши предыдущие исследования также продемонстрировали, что повреждение седалищного нерва не вызывает какой-либо значительной потери спинномозговых мотонейронов и не влияет на их способность регенерировать в дистальную культю нерва [5], [6]. Таким образом, невозможность продолжения аксонов от трансплантата к хронически денервированной дистальной культи, скорее всего, является одним из основных препятствий для реиннервации периферических мишеней.В более позднем исследовании Gordon et al. было показано, что хронически денервированный нервный трансплантат значительно снижает способность поддерживать регенерацию, предполагая либо снижение нейротрофической поддержки со стороны шванновских клеток, либо увеличение экспрессии молекул, ингибирующих регенерацию [30]. В том же исследовании было показано, что как хроническая денервация культи нерва, так и хроническая денервация мышцы были самым большим препятствием для восстановления мышечной функции [30]. Оба эти фактора могут повлиять на наши результаты.

Наше исследование показало, что хроническая аксотомия значительно снижает количество шванновских клеток в дистальной культи, но не влияет на их нейротрофический и стимулирующий рост потенциал в культуре. После аксотомии шванновские клетки дедифференцируются и активируют различные факторы роста и молекулы внеклеточного матрикса, которые обеспечивают благоприятную среду для регенерации нервов. Мы обнаружили, что уровни S100B, шванновского производителя клеток, снизились в дистальной культи в группах отсроченной репарации через 3 и 6 месяцев.Это наводит на мысль, что количество шванновских клеток уменьшается при длительной денервации. Наши результаты in vitro подтвердили уменьшение количества шванновских клеток, которые можно выделить из этих дистальных нервных сегментов. Предыдущие исследования показали, что замедленная репарация нерва увеличивает количество апоптотических, каспазо-3-положительных шванновских клеток как в месте поражения, так и в дистальной культи [31]. Та же группа показала, что активирующий фактор транскрипции 3, молекула, участвующая в регенерации, подавляется в шванновских клетках после отсроченной репарации нервов [32].Гибель шванновских клеток происходит в условиях ишемии [33], и было показано, что она опосредуется такими молекулами, как фактор некроза опухоли [34], которые могут действовать через рецептор нейротрофина p75 с низким сродством [35]. Шванновские клетки, которые мы смогли выделить и размножить из более длительно денервированных дистальных культей, экспрессировали аналогичные уровни рецепторов erbB и пролиферировали в ответ на нейрегулин с такой же скоростью, что и нормальные шванновские клетки. Ранее было показано, что уровни экспрессии erbB2 и erbB4 в денервированных шванновских клетках значительно снижаются через 4 месяца после денервации и не обнаруживаются через 6 месяцев денервированных нервов [36].Причина, по которой мы наблюдали высокие уровни erbB2 в культурах отсроченного восстановления нервов, может быть связана с шванновскими клетками, которые мигрировали из проксимальной культи с несколькими регенерирующими аксонами. Тем не менее, наш анализ in vivo дистальных сегментов выявил сходные уровни экспрессии erbB2 во всех изученных временных точках. Однако уровни erbB4 были значительно снижены после 3 месяцев отсроченного восстановления нерва. Введение глиального фактора роста в хронически денервированные шванновские клетки усиливает их пролиферацию [37], что соответствует нашим результатам in vitro.

Шванновские клетки, пережившие длительную денервацию, потенциально могли иметь нарушение нейротрофической активности. Исследование Hoke et al. Показало, что снижение экспрессии фактора роста, происходящего от линии глиальных клеток, связано с нарушением регенерации аксонов после длительной денервации шванновских клеток [38]. Кроме того, непрерывное долгосрочное применение нейротрофического фактора, происходящего из экзогенной линии глиальных клеток, способно обратить вспять негативные эффекты хронической аксотомии и значительно улучшить регенерацию двигательных нейронов [39].Мы изучили шванновские клетки, обнаруженные в дистальном отделе культи после восстановления нерва. Независимо от задержки во времени восстановления, все культуры шванновских клеток могут поддерживать рост нейритов из линии клеток, подобных мотонейрону NG108-15. Это предполагает, что хронически денервированные шванновские клетки могут быть повторно активированы регенерированием аксонов [40]. Аналогичным образом обработка хронически денервированных нервных трансплантатов TGF-β и форсколином может усилить регенерацию дистальной культи [41]. Однако мы не можем исключить возможность того, что нейротрофические эффекты, которые мы наблюдаем in vitro, полностью опосредованы шванновскими клетками, мигрирующими из проксимальной культи.

В дополнение к предполагаемому снижению количества шванновских клеток в дистальных отделах культей животных, подвергающихся длительной задержке восстановления, мы обнаружили, что количество ингибирующих молекул подвергалось повышенной регуляции. TGF-β был указан как фактор, опосредующий образование рубцов, и исследования показали, что нейтрализация этой молекулы может усилить регенерацию нервов [42]. Мы обнаружили повышенный уровень экспрессии гена TGF-β с задержкой восстановления нервов. Однако, что интересно, мы не обнаружили значительного увеличения экспрессии коллагена, который известен как главный механический барьер для регенерации через рубец [43].Было обнаружено, что тенасцин C, другая молекула, связанная с фиброзом и нарушением регенерации в ЦНС [44], активируется после 3 и 6 месяцев задержки восстановления нерва. Хондроитинсульфат протеогликаны (CSPG), наиболее часто изучаемые в глиальных рубцах ЦНС, также активируются после повреждения периферических нервов [45], но их ингибирующая активность, скорее всего, преодолевается за счет деградации матриксных металлопротеиназ, экспрессируемых шванновскими клетками. Тем не менее восстановление периферических нервов можно стимулировать применением фермента хондроитиназы, который разрушает CSPG [46].Мы обнаружили, что базовая экспрессия генов как фосфакана, так и версикана в дистальной культе нерва была восстановлена ​​немедленно, но наблюдалось значительное увеличение экспрессии фосфакана и, в меньшей степени, версикана в сегментах после 6-месячной отсроченной репарации.

Таким образом, мы обнаружили, что дистальная культя продемонстрировала пониженную способность поддерживать регенерацию после отсроченного восстановления нерва, скорее всего, в результате уменьшения количества шванновских клеток и увеличения фиброза или рубцевания. Эти наблюдения согласуются с нарушением реиннервации мишеней, на что указывает снижение массы икроножных мышц в группах, подвергшихся 3 и 6-месячной отсроченной репарации нерва.В исследовании, аналогичном нашему, Kobayashi et al., Выполнили перерезки большеберцового нерва крысы и восстановили их немедленно или с задержкой до 12 месяцев [47]. В отличие от наших результатов было показано, что регенерация аксонов была отличной во всех группах, независимо от периода денервации. Однако в группах, подвергшихся отложенному восстановлению более 1 месяца, наблюдалось значительное снижение мышечной массы, что согласуется с нашими данными. Изменения, которые происходят в денервированной мышце, первоначально включают миогенную регенеративную реакцию на повреждение нерва с последующей прогрессирующей атрофией и, если денервация продолжается, последующая гибель клеток миофибрилл [48].В лицевой мышце крысы было показано, что активированные сателлитные клетки могут сохраняться до 8 недель, и более быстрое время восстановления коррелирует с увеличением количества клеток и миогенным ответом [15]. При длительной денервации как сателлитные клетки, так и зрелые миофибриллы подвергаются апоптозу, а мышечная ткань замещается фиброзным рубцом и жировой тканью. Икроножная мышца крысы имеет фенотип смешанных волокон, и наши результаты показывают, что волокна быстрого типа более чувствительны к атрофии денервации.Либо волокна медленного типа обладают большей способностью сохранять свой размер при денервации, либо они восстанавливаются быстрее / предпочтительно реиннервируются, чем быстрые волокна. Эти изменения фенотипа будут иметь последствия для функциональной производительности мышцы. В соответствии с морфологическими изменениями атрофии денервированных мышц мы также наблюдали изменения на уровне нервно-мышечных соединений. Дестабилизация НМС после повреждения нерва приводит к нарушению функционального восстановления. Предыдущие исследования выдвинули гипотезу, что изменения в уровнях экспрессии различных субъединиц nAChR могут вносить вклад в этот процесс [49], [50].В нашем исследовании у крыс, перенесших отсроченное восстановление нерва через 3 и 6 месяцев, была обнаружена повышенная экспрессия эмбриональной специфической субъединицы γ-nAChR, что свидетельствует о плохой реиннервации. Специфическая для мышц рецепторная тирозинкиназа, MuSK, является важным белком, необходимым для координации кластеризации nAChR и дифференцировки NMJ. Предыдущие исследования показали, что уровни MuSK активируются во время аневральной стадии регенерации мышц [51], [52]. По сравнению с контрольной мышцей мы обнаружили, что экспрессия MuSK в мышце прогрессивно увеличивалась с более длительной задержкой восстановления нервов, что позволяет предположить, что в более ранние моменты времени реиннервация восстановила уровни экспрессии до нормальных значений.

В заключение наши результаты показывают, что дистальный сегмент перерезанного нерва имеет решающее значение с точки зрения ограничения регенерации и реиннервации нерва после отсроченной репарации. Точка «отсечки» в этой экспериментальной модели на крысах, по-видимому, составляет 3 месяца, после этой точки функциональный результат отсроченного восстановления нерва, вероятно, будет ограничен. Не кажется абсолютно важным выполнять восстановление нерва немедленно, поскольку результаты подсчета аксонов между немедленным ремонтом и отсроченным ремонтом через 1 месяц сопоставимы.Однако ретроградная дегенерация нейронов в DRG проявляется уже через 2 недели после повреждения нерва [53], [54], а отсроченная репарация нерва может привести к снижению восстановления чувствительности. Тем не менее, мы надеемся, что данные, представленные в этом исследовании, смогут помочь хирургам выбрать время восстановления нерва.

Благодарности

Мы хотели бы поблагодарить Gunnel Folkesson и Gunvor Hällström за их отличную техническую помощь.

Заявление о финансировании

Это исследование было поддержано Шведским советом по медицинским исследованиям, Европейским союзом, Университетом Умео, графство Вестерботтен, Оке Вибергс Штифтелсе, Магнусом Бергваллс Стифтельсе, Миннесфондом Класа Грошинскиса и Фондом Гунвора и Йозефа Анеров.Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Список литературы

1.
Wiberg M, Terenghi G (2003) Будет ли возможно производить периферические нервы?
Surg Technol Int
11: 303–310. [PubMed] [Google Scholar] 2.
Lad SP, Nathan JK, Schubert RD, Boakye M (2010) Тенденции травм срединного, локтевого, лучевого и плечевого нервов в Соединенных Штатах. Нейрохирургия
66: 953–960. [PubMed] [Google Scholar] 3.
Vejsada R, Sagot Y, Kato AC (1995) Количественное сравнение временных спасательных эффектов нейротрофических факторов на аксотомизированных мотонейронах in vivo.Eur J Neurosci
7: 108–115. [PubMed] [Google Scholar] 4.
Новикова Л., Новиков Л., Келлерт Дж. (1997) Постоянное маркирование нейронов ретроградными флуоресцентными индикаторами: сравнение Fast Blue, Fluoro-Gold и различных конъюгатов декстрана. J Neurosci методы
74: 9–15. [PubMed] [Google Scholar] 5.
Велин Д., Новикова Л.Н., Виберг М., Келлерт Ю.О., Новиков Л.Н. (2008) Выживание и регенерация кожных и мышечных афферентных нейронов после повреждения периферических нервов у взрослых крыс. Exp Brain Res
186: 315–323.[PubMed] [Google Scholar] 6.
Дживан С., Новикова Л.Н., Виберг М., Новиков Л.Н. (2006) Влияние отсроченной репарации нерва на выживаемость нейронов и регенерацию аксонов после седьмой аксотомии шейного спинномозгового нерва у взрослых крыс. Exp Brain Res
170: 245–254. [PubMed] [Google Scholar] 7.
Ма Дж, Новиков Л.Н., Виберг М., Келлерт Дж.О. (2001) Отсроченная потеря спинномозговых мотонейронов после повреждения периферических нервов у взрослых крыс: количественное морфологическое исследование. Exp Brain Res
139: 216–223. [PubMed] [Google Scholar] 8.
Новиков Л.Н., Новикова Л.Н., Холмберг П., Келлерт Дж.О. (2000) Экзогенный нейротрофический фактор головного мозга регулирует синаптический состав мотонейронов взрослых крыс с повреждением аксонов и нормальных.Неврология
100: 171–181. [PubMed] [Google Scholar] 9.
Tandrup T, Woolf CJ, Coggeshall RE (2000) Отсроченная потеря маленьких ганглиозных клеток дорсального корешка после перерезки седалищного нерва крысы. J Comp Neurol
422: 172–180. [PubMed] [Google Scholar] 10.
Lundborg G (2000) 25-летняя перспектива хирургии периферических нервов: развивающиеся нейробиологические концепции и клиническое значение. J Hand Surg [Am]
25: 391–414. [PubMed] [Google Scholar] 11.
Fu SY, Gordon T (1995) Факторы, способствующие плохому функциональному восстановлению после отсроченного восстановления нерва: длительная аксотомия.J Neurosci
15: 3876–3885. [Бесплатная статья PMC] [PubMed] [Google Scholar] 12.
Fu SY, Gordon T (1995) Факторы, способствующие плохому функциональному восстановлению после отсроченного восстановления нерва: длительная денервация. J Neurosci
15: 3886–3895. [Бесплатная статья PMC] [PubMed] [Google Scholar] 13.
Эшли З., Сазерленд Х., Ланмюллер Х., Рассольд М.Ф., Унгер Э. и др. (2007) Атрофия, но не некроз скелетных мышц кроликов, денервированных на срок до одного года. Am J Physiol Cell Physiol
292: C440 – C451. [PubMed] [Google Scholar] 14.Midrio M (2006) Денервированные мышцы: факты и гипотезы. Исторический обзор. Eur J Appl Physiol
98: 1–21. [PubMed] [Google Scholar] 15.
Чен Д., Чен С., Ван В., Лю Ф., Чжан С. и др. (2010) Модуляция сателлитных клеток в лицевых мышцах крысы после денервации и отсроченной реиннервации. Акта Отоларингол
130: 1411–1420. [PubMed] [Google Scholar] 16.
Jejurikar SS, Kuzon WM Jr (2003) Истощение сателлитных клеток в дегенеративных скелетных мышцах. Апоптоз
8: 573–578. [PubMed] [Google Scholar] 17.Брауэр К.А., Уотерс П.М. (2007) Экономический анализ сроков микрохирургической реконструкции при родовом параличе плечевого сплетения. J Bone Joint Surg Am
89: 970–978. [PubMed] [Google Scholar] 18.
Wiberg M, Backman C, Wahlstrom P, Dahlin LB (2009) [Травмы плечевого сплетения у взрослых. Ранняя реконструкция для лучших клинических результатов. Lakartidningen
106: 586–590. [PubMed] [Google Scholar] 19.
Ruijs AC, Jaquet JB, Kalmijn S, Giele H, Hovius SE (2005) Повреждения срединного и локтевого нерва: метаанализ предикторов моторного и сенсорного восстановления после современной микрохирургической пластики нерва.Пласт Реконстр Сург
116: 484–494. [PubMed] [Google Scholar] 20.
Дживан С., Кумар Н., Виберг М., Кей С. (2009) Влияние предоперационной задержки на функциональный результат после реконструкции травм плечевого сплетения. J Plast Reconstr Aesthet Surg
62: 472–479. [PubMed] [Google Scholar] 21.
Розенфилд Дж., Паксима Н. (2001) Повреждения и восстановление периферических нервов в верхней конечности. Bull Hosp Jt Dis
60: 155–161. [PubMed] [Google Scholar] 22.
Susarla SM, Kaban LB, Donoff RB, Dodson TB (2007) Улучшает ли раннее восстановление повреждений язычного нерва функциональное сенсорное восстановление?
J Oral Maxillofac Surg
65: 1070–1076.[PubMed] [Google Scholar] 23.
Далин Л. Б., Анагностаки Л., Лундборг Г. (2001) Тканевая реакция на силиконовые трубки, используемые для восстановления срединных и локтевых нервов человека. Scand J Plast Reconstr Surg Ручная хирургия
35: 29–34. [PubMed] [Google Scholar] 24.
McKay Hart A, Brannstrom T, Wiberg M, Terenghi G (2002) Первичные сенсорные нейроны и сателлитные клетки после периферической аксотомии у взрослой крысы: временной ход гибели и элиминации клеток. Exp Brain Res
142: 308–318. [PubMed] [Google Scholar] 25.
Armstrong SJ, Wiberg M, Terenghi G, Kingham PJ (2007) Молекулы ECM опосредуют как пролиферацию шванновских клеток, так и активацию для усиления роста нейритов.Tissue Eng
13: 2863–2870. [PubMed] [Google Scholar] 26.
Kou Y, Zhang P, Yin X, Wei SY, Wang Y и др. (2010) Влияние различных периодов дегенерации дистальных нервов на регенерацию коллатеральных отростков периферических нервов. Artif Cells Blood Substit Immobil Biotechnol
39: 223–227. [PubMed] [Google Scholar] 27.
Ронкко Х., Горанссон Х., Сийронен П., Таскинен Х.С., Вуоринен В. и др. (2011) Способность дистальной культи периферического нерва принимать растущие аксоны после двух и шести месяцев денервации. Сканд Дж Сург
100: 223–229.[PubMed] [Google Scholar] 28.
Миямото Ю., Сугита Т., Хигаки Т., Икута Ю., Цуге К. (1985) Продолжительность денервации и регенерации при пересадке нервов. Количественная гистологическая оценка у крысы. Int Orthop
9: 271–276. [PubMed] [Google Scholar] 29.
Ма Дж, Новиков Л.Н., Келлерт Дж.О., Виберг М. (2003) Раннее восстановление нерва после повреждения постганглионарного сплетения: экспериментальное исследование выживания сенсорных и моторных нейронов у взрослых крыс. Scand J Plast Reconstr Surg Ручная хирургия
37: 1–9. [PubMed] [Google Scholar] 30.Гордон Т., Тайреман Н., Раджи М.А. (2011) Основа снижения функционального восстановления после отсроченного восстановления периферических нервов. J Neurosci
31: 5325–5334. [Бесплатная статья PMC] [PubMed] [Google Scholar] 31.
Saito H, Kanje M, Dahlin LB (2009) Задержка восстановления нервов увеличивает количество окрашенных каспазой 3 шванновских клеток. Neurosci Lett
456: 30–33. [PubMed] [Google Scholar] 33.
Keilhoff G, Schild L, Fansa H (2008) Миноциклин защищает шванновские клетки от ишемического повреждения и способствует разрастанию аксонов в биоискусственных нервных трансплантатах без валлеровской дегенерации.Опыт Neurol
212: 189–200. [PubMed] [Google Scholar] 34.
Boyle K, Azari MF, Cheema SS, Petratos S (2005) TNFalpha опосредует гибель шванновских клеток, регулируя экспрессию p75NTR без длительной активации NFkappaB. Нейробиол Дис
20: 412–427. [PubMed] [Google Scholar] 35.
Syroid DE, Maycox PJ, Soilu-Hanninen M, Petratos S, Bucci T. и др. (2000) Индукция постнатальной гибели шванновских клеток под действием низкоаффинного рецептора нейротрофина in vitro и после аксотомии. J Neurosci
20: 5741–5747. [Бесплатная статья PMC] [PubMed] [Google Scholar] 36.Ли Х, Теренги Г., Холл С.М. (1997) Эффекты отсроченной реиннервации на экспрессию рецепторов c-erbB хронически денервированными шванновскими клетками крысы in vivo. Глия
20: 333–347. [PubMed] [Google Scholar] 37.
Li H, Wigley C, Hall SM (1998) Хронически денервированные крысиные шванновские клетки отвечают на GGF in vitro. Глия
24: 290–303. [PubMed] [Google Scholar] 38.
Hoke A, Gordon T, Zochodne DW, Sulaiman OA (2002) Снижение экспрессии нейротрофического фактора, происходящего от линии глиальных клеток, связано с нарушением регенерации после длительной денервации шванновских клеток.Опыт Neurol
173: 77–85. [PubMed] [Google Scholar] 39.
Boyd JG, Gordon T (2003) Нейротрофический фактор, полученный из линии глиальных клеток, и нейротрофический фактор, полученный из мозга, поддерживают регенерацию аксонов хронически аксотомированных мотонейронов in vivo. Опыт Neurol
183: 610–619. [PubMed] [Google Scholar] 40.
Rueger MA, Aras S, Guntinas-Lichius O, Neiss WF (2008) Реактивация атрофических моторных шванновских клеток после анастомоза подъязычно-лицевого нерва. Neurosci Lett
434: 253–259. [PubMed] [Google Scholar] 41.
Сулейман О.А., Гордон Т. (2002) Трансформирующий фактор роста-бета и форсколин ослабляют неблагоприятные эффекты долгосрочной денервации шванновских клеток на регенерацию периферических нервов in vivo.Глия
37: 206–218. [PubMed] [Google Scholar] 42.
Davison SP, McCaffrey TV, Porter MN, Manders E (1999) Улучшенная регенерация нервов с нейтрализацией трансформирующего фактора роста-бета1. Ларингоскоп
109: 631–635. [PubMed] [Google Scholar] 43.
Siironen J, Vuorinen V, Taskinen HS, Roytta M (1995) Регенерация аксонов в хронически денервированную дистальную культю. 2. Активная экспрессия мРНК коллагена I типа в эпиневрии. Acta Neuropathol
89: 219–226. [PubMed] [Google Scholar] 44.
Пицци М.А., Кроу М.Дж. (2007) Матричные металлопротеиназы и протеогликаны в регенерации аксонов.Опыт Neurol
204: 496–511. [PubMed] [Google Scholar] 45.
Zuo J, Hernandez YJ, Muir D (1998) Хондроитинсульфат-протеогликан с ингибирующей нейрит активностью активируется после повреждения периферического нерва. J Neurobiol
34: 41–54. [PubMed] [Google Scholar] 46.
Muir D (2009) Потенцирование оболочек периферических нервов при регенерации и восстановлении. Опыт Neurol
223: 102–111. [PubMed] [Google Scholar] 47.
Кобаяши Дж., Маккиннон С.Е., Ватанабэ О, Болл Диджей, Гу ХМ и др. (1997) Влияние продолжительности мышечной денервации на функциональное восстановление на крысиной модели.Мышечный нерв
20: 858–866. [PubMed] [Google Scholar] 48.
Борисов А.Б., Дедков Е.И., Карлсон Б.М. (2001) Взаимосвязь миогенного ответа, прогрессирующей атрофии мышечных волокон и гибели клеток в денервированных скелетных мышцах. Анат Рек
264: 203–218. [PubMed] [Google Scholar] 49.
Апель П.Дж., Альтон Т., Нортам К., Ма Дж., Каллахан М. и др. (2009) Как возраст ухудшает реакцию нервно-мышечного соединения на перерезку и восстановление нерва: экспериментальное исследование на крысах. J Orthop Res
27: 385–393. [Бесплатная статья PMC] [PubMed] [Google Scholar] 50.Ма Дж., Шен Дж., Гарретт Дж. П., Ли К.А., Ли Зи и др. (2007) Экспрессия генов миогенных регуляторных факторов, субъединиц никотинового ацетилхолинового рецептора и GAP-43 в скелетных мышцах после денервации на модели крыс. J Orthop Res
25: 1498–1505. [PubMed] [Google Scholar] 51.
Хашемолхоссейни С., Мур С., Ландманн Л., Сандер А., Шварц Н. и др. (2000) Электрическая активность и формирование постсинапса в мышцах взрослых: гамма-AChR не требуются. Mol Cell Neurosci
16: 697–707. [PubMed] [Google Scholar] 52.Шен Дж., Ма Дж., Ли К., Смит Б.П., Смит Т.Л. и др. (2006) Как мышцы восстанавливаются после пареза и атрофии после внутримышечной инъекции ботулинического токсина А: исследование на молодых крысах. J Orthop Res
24: 1128–1135. [PubMed] [Google Scholar] 53.
Reid AJ, Welin D, Wiberg M, Terenghi G, Novikov LN (2009) Гены периферина и ATF3 по-разному регулируются в регенерирующих и не регенерирующих первичных сенсорных нейронах. Brain Res
1310: 1–7. [PubMed] [Google Scholar] 54.
Reid AJ, Mantovani C, Shawcross SG, Terenghi G, Wiberg M (2011) Фенотип отдельных первичных сенсорных афферентных субпопуляций и экспрессия каспазы-3 после аксотомии.Histochem Cell Biol
136: 71–78. [PubMed] [Google Scholar]

шагов по предотвращению или отсрочке повреждения нервов

Вы можете многое сделать, чтобы предотвратить или отсрочить повреждение нервов. И, если у вас уже есть диабетическая невропатия (повреждение нервов), эти шаги могут предотвратить или отсрочить дальнейшее повреждение и могут уменьшить ваши симптомы.

Поддерживайте уровень сахара в крови в целевом диапазоне

Планирование питания, физическая активность и прием лекарств, если необходимо, — все это может помочь вам достичь целевого диапазона.Есть два способа отслеживать уровень сахара в крови:

  • Используйте глюкометр, чтобы принимать решения о повседневном уходе.
  • Проходите тест на A1C (лабораторный тест) не реже двух раз в год, чтобы узнать свой средний уровень сахара в крови за последние 2–3 месяца.

Проверка уровня сахара в крови покажет вам, работает ли ваш план лечения диабета или необходимы изменения.

  • Сообщите о симптомах диабетической невропатии.
  • Если у вас возникли проблемы, немедленно обратитесь за помощью.Раннее лечение может помочь предотвратить появление новых проблем в будущем. Например, если вы заблаговременно позаботитесь о инфекции стопы, это поможет предотвратить ампутацию.
  • Позаботьтесь о своих ногах. Проверяйте ноги каждый день. Если вы больше не чувствуете боли в ногах, вы можете не заметить травму стопы. Вместо этого ищите проблемы глазами. Воспользуйтесь зеркалом, чтобы увидеть ступни. Руками нащупайте горячие или холодные точки, неровности или сухую кожу. Ищите язвы, порезы или трещины на коже. Также проверьте наличие натоптышей, мозолей, волдырей, красных участков, отеков, вросших ногтей на ногах и инфекций ногтей на ногах.Если вам трудно видеть или дотянуться до ног, обратитесь за помощью к члену семьи или педиатру.
  • Защитите ноги. Если у вас сухие ноги, нанесите лосьон на кожу, но не между пальцами ног. Носите подходящую обувь и носки и носите их постоянно. Вымойте ноги теплой водой, а затем тщательно высушите их.
  • При необходимости приобретите специальную обувь. Если у вас проблемы с ногами, Medicare может оплатить покупку обуви. Спросите об этом у своей медицинской бригады.
  • Будьте осторожны при выполнении упражнений.Некоторые физические нагрузки небезопасны для людей с невропатией. Поговорите со специалистом по клиническим упражнениям при диабете, который поможет вам.

Исследования нервной проводимости: основы и подводные камни на практике

Невролог отправил пациента на исследование нервной проводимости (NCS) и получил отчет, но что это означает? Мы надеемся устранить некоторые загадки, которые могут окружать NCS. В общих чертах описаны методы и то, как на них влияет болезнь.Эти принципы могут применяться к конкретным условиям, обсуждаемым в другом месте. Мы также обсуждаем многочисленные подводные камни, с которыми можно столкнуться при использовании NCS. Понимание этих основных концепций позволит вам получить максимальную отдачу от вашего отделения клинической нейрофизиологии.

NCS являются лишь частью полного периферического нейрофизиологического исследования (PNE) и часто сопровождаются игольчатой ​​электромиограммой (EMG). Комбинация обоих методов и методов, подробно описанных в других статьях этого выпуска, часто требуется для полноценного диагностического исследования.Процесс выбора подходящих тестов является обязанностью клинического нейрофизиолога (CN), а не лечащего врача, и он спланирован как динамическая серия шагов, разработанных для ответа на конкретные вопросы о функции нервной системы, возникающие в связи с клинической картиной.

СОКРАЩЕНИЯ

Клинические нейрофизиологи могут использовать непонятное количество терминов и сокращений. Во вставке 1 перечислены те, которые мы часто используем.

Вставка 1:

Список используемых сокращений и терминологии

  • АЧ: ацетилхолин

  • AIDP: острая воспалительная демиелинизирующая полинейропатия

  • AMAN: острая моторная аксональная нейропатия

  • CMAP: потенциал действия сложной мышцы

  • CN: клинический нейрофизиолог

  • DRG: ганглий дорзального корня

  • ЭМГ: электромиограмма

  • LEMS: Миастенический синдром Ламберта-Итона

  • MG: миастения гравис

  • NAP: потенциал нервного действия

  • NCS: Исследования нервной проводимости

  • NMTD: Нарушения нервно-мышечной передачи

  • PNE: периферическое нейрофизиологическое обследование

  • PNS: периферическая нервная система

  • RNS: Повторная стимуляция нервов

  • SNAP: потенциал действия сенсорного нерва

  • ТМС: транскраниальная магнитная стимуляция

  • Блок проводимости: Уменьшение проксимальной площади / амплитуды CMAP не менее чем на 20% (обычно> 50%) по сравнению с дистальной площадью / амплитудой CMAP.Продолжительность проксимального CMAP не должна увеличиваться> 20% (см. Временную дисперсию)

  • Временная дисперсия: Снижение проксимальной амплитуды CMAP по сравнению с дистальной амплитудой CMAP, когда длительность проксимальной CMAP увеличивается на> 20%

  • Ортодромный: Потенциалы нервного действия, переносимые в физиологическом направлении

  • Антидромный: Потенциалы нервного действия, направленные в направлении, противоположном физиологическому

ЧТО ВЫ СКАЗЫВАЕТЕ ПАЦИЕНТУ ОБ ТЕСТАХ?

NCS включает электрическую активацию нервов небольшими безопасными импульсами в нескольких точках на коже конечностей и измерение полученных ответов.Некоторых пугает термин «поражение электрическим током». Тесты в худшем случае неудобны, но большинство пациентов находят их терпимыми, если им сочувственно объясняют. Нет никаких долгосрочных побочных эффектов. Оба автора неоднократно без труда испытывали собственные нервы, и ни один из нас не стал бы заявлять об особо высоких болевых порогах. Самостоятельная демонстрация CN может быть полезна более тревожным пациентам, так же как и простой информационный лист.

Противопоказаний к этим исследованиям очень мало, но наиболее важным является наличие кардиостимуляторов.В большинстве случаев риск отсутствует, но рекомендуется обсудить с кардиологом пациента, если (1) NCS может включать стимуляцию вблизи грудной стенки, и (2) если возникнет угроза для жизни в случае срабатывания кардиостимулятора или изменяется на опасное состояние по умолчанию, если на него действует внешнее напряжение.

НАПРАВЛЕНИЕ ПАЦИЕНТОВ ДЛЯ ИССЛЕДОВАНИЯ НЕРВНОЙ ПРОВОДКИ

NCS предоставляют данные о функции периферической нервной системы (PNS), которые могут использоваться для предоставления:

  • диагнозы

  • описание болезненного состояния (старое / новое; динамическая / статическая патофизиология)

  • Продольный мониторинг болезни с множественными исследованиями

  • рекомендации по прогнозу и ведению на основании результатов анализов и выявленного заболевания.

Исследования нервной проводимости могут быть диагностически полезными у пациентов с подозрением на практически любое нарушение ПНС, включая заболевания нервных корешков, периферических нервов, мышц и нервно-мышечного соединения. Также можно оценить черепные нервы и функцию спинного мозга. Конкретные клинические показания обсуждаются в другом месте.

При направлении пациентов полезно подумать о конкретных вопросах, на которые вы хотите получить ответы с помощью PNE. В сложных случаях полезно обсудить направление (которое должно содержать всю необходимую клиническую информацию) с CN.PNE является расширением истории болезни и обследования, и CNs будет собирать анамнез и проводить соответствующее неврологическое обследование, но при этом они будут полагаться на справочную информацию. В простых условиях они могут следовать первоначальному стандартному протоколу тестов, но исследователь будет готов изменить или дополнить эти тесты на основе первоначальных результатов. Это подчеркивает, что, когда NCS выполняется техническим персоналом, CN должен осуществлять наблюдение в непосредственной близости и быть доступным для проведения других соответствующих испытаний.Нет необходимости (а иногда и оскорбительно) указывать тесты в направлении, если задаваемый клинический вопрос ясен. Например, у пациента с подозрением на синдром правого запястного канала нет необходимости спрашивать «NCS правого срединного нерва». (Мудрый CN все равно будет изучать оба срединных нерва, поскольку это заболевание часто бывает двусторонним.)

Основы физиологии нервов и мышц

Направляющему врачу необходимы лишь минимальные знания базовой и прикладной физиологии, чтобы понять результаты тестов, но все отчеты PNE должны быть написаны в терминах, не предполагающих специальных знаний.Минимальный набор знаний для понимания принципов методов показан во вставке 2 со ссылками на более подробную информацию.

Вставка 2:

Минимальные базовые физиологические знания для понимания исследований нервной проводимости

  • Мембранный потенциал: генезис; пороговые эффекты; эффект повреждения мембраны; денервация

  • Одиночный аксон: скачкообразная и несальтирующая проводимость; факторы, определяющие скорость проведения: диаметр, миелинизация, межузловое расстояние

  • Состав всего нерва: пучковидная структура; распределение по размерам и скорости проводимости; афферентные и эфферентные модальности и их относительный вклад

  • Нервно-мышечная передача: нервная терминальная функция; изготовление, хранение и выпуск передатчиков; структура и функция постсинаптической мембраны; рецепторная динамика; потенциалы концевой пластинки; Размещенные потенциалы действия мышц

  • Внешняя электрическая / магнитная стимуляция: локальная деполяризация; двунаправленное распространение после деполяризации; эффекты импеданса кожи и подкожной клетчатки; электроиндуктивный эффект приложенного магнитного поля; порог стимуляции зависит от: свойств мембраны (аккомодации), расположения и размера нервных волокон по отношению к стимулятору

  • Функция мышц: сцепление при возбуждении и сокращении; типы и функции мышечных волокон; усталость

Превосходный интерактивный инструмент физиологического образования см. В Neurolab Ричарда Карпентера по адресу http: // www.cudos.ac.uk/web/copyright.htm.

Принципы исследования нервной проводимости

NCS включает в себя приложение деполяризующих прямоугольных электрических импульсов к коже над периферическим нервом, производящих: (1) потенциал действия распространенного нерва (NAP), записанный в удаленной точке над тем же нервом: и (2) сложное мышечное действие потенциал (CMAP), возникающий в результате активации мышечных волокон в целевой мышце, снабжаемой нервом.В обоих случаях они могут регистрироваться поверхностными или игольчатыми электродами.

Поверхностные электроды предназначены для получения информации о стимулируемой мышце в целом, предоставляя данные о времени, затрачиваемом самыми быстрыми аксонами на проведение импульса к мышце, и величине реакции.

Игольчатые электроды

для NCS дают очень точную информацию о времени проведения, но поскольку они регистрируют только небольшую область мышцы или нерва, они дают плохую или, в последнем случае, более сложную информацию, что затрудняет численный анализ.Тем не менее, записи с помощью иглы наиболее подходят, когда произошло серьезное истощение мышц или когда глубина исследуемой мышцы делает невозможным запись на поверхности.

Нервы можно стимулировать через кожу с помощью поверхностных стимуляторов или с помощью иглы, расположенной рядом с нервом или нервным корешком. Стимуляция корешка спинного мозга и коры головного мозга также может выполняться с использованием чрескожной магнитной стимуляции (ТМС), о которой говорится в других разделах этого выпуска. Таким образом, можно оценить полную длину двигательного пути от коры головного мозга до корня, нервно-мышечного соединения и сократительного аппарата.Выбор точек стимуляции зависит как от желания «поставить скобки» выше и ниже точки предполагаемого очагового поражения, так и от анатомической доступности соответствующей структуры.

Цель NCS

Наш минимальный набор знаний, приведенный выше, показал нам, что периферические нервы содержат множество нервных волокон разного диаметра, степени миелинизации и афферентных или эфферентных связей. NCS изучает самые быстрые 20% этих волокон, и цель исследования — документировать очаговые или постоянные аномалии длины смешанного, двигательного или сенсорного нерва.Особое внимание по мере прохождения теста уделяется следующим вопросам:

  • Нормальная ли самая высокая скорость проводимости?

  • Нормальный градиент скорости. Обычно нервы ближе к нервной оси и в большей части головного мозга проводят быстрее, чем более дистальные и каудальные нервы.

  • Соответствует ли CMAP размеру и форме?

  • Меняется ли CMAP по размеру, форме или продолжительности между точками стимуляции?

    • — свидетельство временного разброса (см. Термины, вставка 2).

    • — свидетельство блокирования проводимости (см. Условия в рамке 2).

Нормальные значения для NCS

Соответствующие возрасту «Нормальные» значения параметров NCS либо получены из исследований групп неврологически нормальных субъектов, либо взяты из литературы. К сожалению, по мнению авторов, наиболее часто используемые статистические данные — это пределы 95% или реже 99% доверительных интервалов нормальной группы для указания отклонения от нормы одного параметра.

Этот подход может ввести в заблуждение, поскольку грубое разделение между «нормальным» и «ненормальным» размывает информацию, тогда как Z-оценка, например, указывающая на разделение между одним значением и средним групповым значением, выраженным в SD, может быть более информативным. В качестве альтернативы: (а) ряд электрофизиологических параметров может быть взят вместе либо как «индекс» или «балл», или (б) нейрофизиолог оценивает вместе несколько параметров, чтобы сделать вывод о том, должна ли клинически значимая числовая аномалия подчеркиваться в интерпретации отчета или нет.

Существует ряд физических параметров, требующих корректировки или учета. Самое главное — это температура. Самая быстрая скорость проведения по двигательному нерву (FMNCV) снижается примерно на 1 м / с при падении температуры на ° C. Обычно исследования проводятся при температуре, близкой к зарегистрированной на поверхности 34 ° C. Если это не достигается за счет надлежащего нагрева или конечности, редко требуется коррекция температуры. Некоторые меры проводимости требуют поправки на длину или высоту конечности.Наконец, данные о нервной проводимости меняются с возрастом. Моторная проводимость замедляется на 0,4–1,7 м / с за десятилетие после 20 лет, а сенсорная — на 2–4 м / с.

СПЕЦИАЛЬНЫЕ МЕТОДЫ ИССЛЕДОВАНИЯ НЕРВНОЙ ПРОВОДИМОСТИ

Исследования проводимости двигательных нервов

Двигательные исследования выполняются путем электростимуляции нерва и регистрации потенциала действия сложной мышцы (CMAP) с поверхностных электродов, лежащих над мышцей, снабжаемой этим нервом.

Регистрирующие электроды выполняются с помощью липких проводящих подушечек, размещаемых на коже над целевой мышцей.Активный электрод размещают над мышечным животом, а эталон — над электрически неактивным участком (обычно над мышечным сухожилием). Заземляющий электрод также помещается где-то между стимулирующим и регистрирующим электродами, обеспечивая точку отсчета нулевого напряжения. Срединное двигательное исследование может включать стимуляцию запястья, локтя и, реже, подмышечной впадины и плечевого сплетения (рис. 1A, B).

Рисунок 1

(А, В). Исследование проводимости срединного двигательного нерва.Активный записывающий электрод располагается над мышцами APB со стимуляцией запястья, локтя, подмышечной впадины и плечевого сплетения. Панель B показывает двигательный ответ на стимуляцию на всех четырех участках. Ответы имеют ту же форму, но латентность больше при более проксимальной стимуляции. (C) Составной мышечный потенциал действия (CMAP) и его параметры.

CMAP — это суммарный ответ напряжения от индивидуальных потенциалов действия мышечных волокон. Самая короткая задержка CMAP — это время от артефакта стимула до начала реакции и представляет собой двухфазный ответ с начальным отклонением вверх, за которым следует меньшее отклонение вниз.Амплитуда CMAP измеряется от базовой линии до отрицательного пика (нейрофизиологическое соглашение заключается в том, что отрицательное напряжение демонстрируется отклонением вверх) и измеряется в милливольтах (мВ) (рис. 1C).

Для записи CMAP стимулирующий ток или напряжение постепенно увеличивают до тех пор, пока не будет достигнута точка, в которой увеличение стимула не приводит к увеличению амплитуды CMAP. Только в этой (супрамаксимальной) точке можно точно записать воспроизводимые значения амплитуды CMAP и задержки между стимулом и началом CMAP.

Затем нерв стимулируется в более проксимальном месте — в срединном нерве это будет переднубитальная ямка, рядом с сухожилием двуглавой мышцы. В нормальном состоянии стимуляция срединного нерва в запястье и локте приводит к двум CMAP схожей формы и амплитуды, потому что одни и те же моторные аксоны иннервируют мышечные волокна, составляющие реакцию. Однако при стимуляции локтя задержка будет больше, чем при стимуляции запястья, из-за большего расстояния между стимулирующим и регистрирующим электродами (рис. 1B).Разница в латентном периоде представляет собой время, необходимое для проведения самыми быстрыми нервными волокнами между двумя точками стимуляции, поскольку все другие факторы, включая нервно-мышечную передачу и активацию мышц, являются общими для обоих участков стимуляции. Если измерить расстояние между двумя сайтами, то самая быстрая скорость проведения двигательного нерва может быть рассчитана следующим образом: FMNCV (м / с) = расстояние между сайтом стимуляции 1 и сайтом 2 (мм) / [латентный сайт 2 — латентный сайт 1 ( РС)].

Исследования сенсорной проводимости

Потенциал действия сенсорного нерва (SNAP) получается путем электрической стимуляции сенсорных волокон и регистрации потенциала действия нерва в точке, расположенной дальше вдоль этого нерва.И снова стимул должен быть сверхмаксимальным.

Ортодромная запись SNAP относится к стимуляции дистального нерва и более проксимальной записи (направление, в котором происходит физиологическая сенсорная проводимость). Антидромное тестирование — обратное. Разные лаборатории предпочитают антидромные или ортодромные методы тестирования разных нервов. Ортодромное медианное сенсорное исследование показано на рис. 2. Измеряются сенсорная латентность и размах амплитуды SNAP. Скорость напрямую коррелирует с сенсорной задержкой, и поэтому результат может быть выражен как задержка на стандартном расстоянии или как скорость.

Рисунок 2

Среднее ортодромное сенсорное исследование. Цифровые нервы указательного пальца стимулируются с помощью кольцевых электродов, и реакция записывается по срединному нерву на запястье.

Только сенсорные волокна с наибольшим диаметром 20% и самой быстрой проводимостью проверяются с помощью обычных сенсорных исследований, функционально обеспечивающих тонкое прикосновение, вибрацию и определение положения. Преимущественно нейропатии мелких волокон, поражающие остальные 80% волокон, обычно имеют выраженные симптомы боли, и обычные сенсорные исследования могут быть нормальными.В таких случаях потребуется количественное сенсорное тестирование и вегетативное тестирование, которые выходят за рамки данной статьи (см. Ошибки интерпретации).

F волны

F-волн (F для стопы, где они были впервые описаны) представляют собой тип поздней двигательной реакции. Когда аксон двигательного нерва электрически стимулируется в любой точке, потенциал действия распространяется в обоих направлениях от исходного места стимуляции. Дистально распространяющийся импульс вызывает CMAP.Однако импульс также проходит проксимально к клетке переднего рога, деполяризуя бугорок аксона и вызывая ответный удар аксона. Это приводит к небольшой дополнительной деполяризации мышц (волна F) с более длительным латентным периодом. Только около 2% аксонов реагируют на каждый стимул. В отличие от М-ответа (рис. 3), волны F различаются по латентности и форме, потому что разные популяции нейронов обычно вызывают обратную реакцию с каждым стимулом. Самым надежным показателем F-волны является минимальная задержка в 10–20 срабатываний.

Рисунок 3

Схематическое изображение раннего М-ответа от дистально распространенного потенциала действия и более поздней F-волны от проксимально распространяющегося потенциала действия.Последний деполяризует бугорок аксона, вызывая обратный эффект. Фактические ответы волны F показаны на нижнем графике. Волны F различаются по латентности и форме из-за того, что разные популяции аксонов каждый раз отражаются друг от друга.

Чем полезны волны F?

Волны

F позволяют тестировать проксимальные сегменты нервов, которые в противном случае были бы недоступны для обычных исследований нервной проводимости. Волны F проверяют длинные отрезки нервов, тогда как двигательные исследования проверяют более короткие отрезки.Следовательно, аномалии зубца F могут быть чувствительным индикатором патологии периферических нервов, особенно если они расположены проксимально. Коэффициент F волны, который сравнивает проводимость в проксимальной половине общего пути с дистальным, можно использовать для определения места замедления проводимости, например, чтобы отличить поражение корня от пациента с дистальной генерализованной невропатией.

Ошибки

Основными источниками небиологических ошибок в измерениях NCS являются идентификация и измерение начала формы волны и измерение длины нервного сегмента на конечности.Расчеты показали, что в нерве со скоростью проводимости 50 м / с экспериментальная ошибка 2 × SD для скорости составляет 14 м / с на 10 см и 4,7 м / с на 25 см. Из погрешности измерение времени составляет 92,3%, а расстояние 7,7%, поэтому использование рулетки вполне адекватно в обычных NCS.

ИССЛЕДОВАНИЯ НЕРВНОЙ ПРОВОДКИ ПРИ ЗАБОЛЕВАНИИ

Общие

NCS предоставляет информацию для определения местоположения повреждений на длине нерва и патофизиологическую информацию.Патология периферических нервов в первую очередь поражает аксоны или миелин. В действительности две патологии часто сосуществуют, но обычно преобладает одна (таблица 1).

Стол 1

Типичные аномалии нервной проводимости, наблюдаемые при потере аксона или демиелинизации

При очаговых поражениях характеристика патофизиологического процесса может быть важной для определения прогноза. Пациент с параличом лучевого нерва в области спиральной канавки, вызывающей опускание запястья, с большей вероятностью выздоровеет полностью и быстрее (6–12 недель), если это в основном связано с очаговой демиелинизацией и / или блокадой проводимости (нейропраксией), чем при значительном Также имело место аксональное повреждение (6–12 месяцев).

В обобщенных процессах также важно определить, является ли периферическая нейропатия демиелинизирующей или аксональной, поскольку это повлияет на дальнейшие исследования и лечение. Например, острая воспалительная демиелинизирующая полинейропатия (AIDP или синдром Гийена-Барре) приводит к характерному типу демиелинизации сегментарного нерва и может лечиться иммуноглобулином человека или плазмообменом. И наоборот, зависимая от длины аксональная нейропатия, развивающаяся у пациента, получающего химиотерапию, требует переоценки химиотерапии или добавления защитного агента.

Невропатии можно классифицировать таким образом патологически, анатомически или электрофизиологически.

Двигатель NCS

При потере аксонов

Наиболее ярким отклонением от нормы является снижение амплитуды CMAP, поскольку меньшее количество функционирующих моторных аксонов связано с мышечными волокнами. Поскольку миелин не затронут, остальные аксоны проводят нормально, и можно было бы ожидать, что латентность и скорость проводимости останутся в норме.Однако с увеличением потери моторных аксонов некоторые из самых быстрых проводящих волокон будут потеряны. Следовательно, латентность дистального отдела моторики может быть немного увеличена (<120% нормального предела), а скорость проведения - немного замедлена (> 80% нормального предела).

Динамика и время инсульта аксона могут повлиять на наблюдаемые аномалии. Сразу после травматического полного пересечения нерва часть нерва дистальнее поражения будет нормальной, так как еще не было времени для дегенерации аксонов.Амплитуда CMAP начнет падать только через несколько дней. И наоборот, если при генерализованной невропатии происходит очень медленная потеря аксонов, оставшиеся непораженные аксоны могут иметь время для прорастания новых соединений с мышечными волокнами, которые потеряли свою иннервацию (коллатеральная реиннервация), и CMAP может оставаться в пределах нормального диапазона амплитуд даже хотя общее количество нервных аксонов меньше. Однако незрелые регенерирующие волокна имеют более низкие скорости из-за эффекта коротких межузловых расстояний, и это приводит к более диспергированному CMAP.

При демиелинизации

С потерей толщины миелина нервная проводимость замедляется, и, если она достаточно серьезна, скачкообразная проводимость нарушается (блокада проводимости). NCS показывает сильно увеличенные моторные латентные периоды и заметно замедленные скорости проводимости. Видимые изменения зависят от места и степени демиелинизации. Если демиелинизация очень проксимальная, тогда латентность дистального мотора и скорость проведения могут быть нормальными, и в этом случае только зубцы F могут показывать аномалии.

Блок проводимости или временная дисперсия приводят к уменьшению амплитуды CMAP. Область CMAP используется для оценки вклада этих двух процессов. При блокаде проводимости наблюдается полное нарушение проводимости в некоторых или во всех исследованных моторных аксонах. Следовательно, зона CMAP при стимуляции проксимальнее места блокады проводимости меньше (уменьшение> 20%) по сравнению с дистальной стимуляцией (рис. 4). Для обнаружения истинной блокады проводимости продолжительность проксимального CMAP не должна увеличиваться более чем на 20%.Во временной дисперсии (рис.4) наблюдается потеря синхронности потенциалов действия нервов, что приводит к потере амплитуды CMAP, потому что положительная часть потенциала действия одного мышечного волокна компенсирует отрицательную часть другого (фазовая отмена) (рис.5). .

Рисунок 4

Оба этих следа показывают демиелинизацию в медианных исследованиях моторики. График слева показывает почти полную блокаду проводимости с отсутствием ответа на проксимальную стимуляцию.График справа показывает временную дисперсию, при которой продолжительность CMAP увеличивается почти на 40% при проксимальной стимуляции. В обеих ситуациях амплитуда CMAP при проксимальной стимуляции меньше.

Рисунок 5

Схематическое изображение отмены фазы и временной дисперсии при демиелинизации. В нормальном нерве ответы синхронизированы во времени и, следовательно, суммируются (амплитуда выше, чем у отдельных компонентов).Временная дисперсия приводит к увеличению продолжительности и уменьшению амплитуды CMAP.

Клинические корреляты замедления скорости моторной проводимости и блокады проводимости

Важно понимать, что само по себе замедление скорости проводимости без блокады проводимости не приводит к слабости, поскольку импульсы по-прежнему передаются от нерва к мышце. Хорошим примером этого является наличие глубокого замедления проводимости двигательного нерва у полностью бессимптомных первичных родственников пациентов с демиелинизирующей наследственной двигательной и сенсорной нейропатией.

Сенсор NCS

При генерализованных расстройствах

И при аксональной, и при демиелинизирующей патологии амплитуда SNAP снижается по разным причинам. Потеря сенсорных аксонов приведет к уменьшению SNAP. Демиелинизация также производит небольшие SNAP, но с большей продолжительностью. Поскольку они имеют гораздо меньшую продолжительность, чем CMAP, они более подвержены фазовой отмене (рис. 5).

Распределение сенсорных аномалий NCS может помочь в определении этиологии.Например, потеря SNAPS в нижних конечностях является обычным явлением при нейропатии отмирания спины аксонов, связанной с такими препаратами, как винкристин, тогда как равное вовлечение SNAPS верхних и нижних конечностей повышает вероятность сенсорной ганглионопатии, такой как связанная с лечением талидомидом.

Очаговые поражения

Множественная сенсорная NCS позволяет исследователю определять сенсорные нейропатии, которые затрагивают один или несколько пальцевых нервов дистально (например, васкулит или синдром вибрации кисти руки) вплоть до основных стволов, связок и отделов плечевого сплетения проксимально.

При травме проксимального нерва поддержание сенсорного потенциала зависит от неповрежденных тел ганглиев задних корешков. Таким образом, сенсорные NCS чрезвычайно полезны при локализации поражения PNS как пре- и / или постганглионарного. У пациента с клинически подозреваемым поражением корня C8, T1 и при соответствующей анестезии в этом дерматоме отсутствие локтевого и медиального кожного сенсорного потенциала передне-плечевого сустава помещает поражение дистальнее ганглия заднего корешка (DRG) в нижнем стволе плечевого сплетение, а не на уровне корня (рис. 6).Затем для дальнейшего определения этого можно использовать игольчатую ЭМГ.

Рисунок 6

Сенсорные реакции нормальны при пре-ганглиозных поражениях, даже если ощущения могут быть ненормальными с клинической точки зрения. Постганглионарные поражения приводят к аномальным сенсорным реакциям. DRG, ганглий дорзального корня.

F волны

Генерализованные расстройства

Зубцы

F чувствительны ко всем формам генерализованной периферической невропатии с их отсутствием или длительным минимальным латентным периодом, возникающим на ранней стадии.Например, при ОВДП, где демиелинизация может быть сегментарной, проксимальной и пятнистой, аномалии зубца F могут быть самыми ранними и (в легких случаях) единственными наблюдаемыми электрофизиологическими аномалиями.

При аксональной патологии латентный период зубца F также может слегка задерживаться в соответствии с замедлением скорости моторной проводимости, вторичным по отношению к потере самых быстро проводящих моторных аксонов.

При двигательных нейронопатиях, таких как болезни двигательных нейронов, удлинение любой латентности волны F является убедительным доказательством либо того, что это неправильный диагноз (например, при мультифокальной двигательной невропатии), либо наличия второго патологического процесса.

Очаговые поражения

Зубцы

F могут отсутствовать при поражении периферических нервов или передних отделов позвоночника. Первоначально считалось, что они очень полезны для выявления индивидуальных аномалий распределения корней. Однако, особенно в верхних конечностях, существенное перекрытие сегментарной иннервации в дистально доступных периферических нервах делает этот тест сам по себе низкой чувствительностью и анатомической специфичностью. Кроме того, эффект демиелинизации ослабляется длиной пути, по которому проходит F-волна.Для определения наличия дистального или проксимального поражения может быть полезным использование коэффициента волны F, который сравнивает латентность волны F в верхней и нижней половинах конечности (обычно используя колено и локоть в качестве разделительной линии).

ПОВТОРНАЯ СТИМУЛЯЦИЯ НЕРВОВ

Повторяющаяся нервная стимуляция (RNS) используется при обследовании пациентов с подозрением на нейромышечные нарушения передачи (NMTD), такие как миастения (MG) или миастенический синдром Ламберта-Итона (LEMS).RNS — это модифицированный моторный NCS, в котором вместо регистрации CMAP с одиночными супрамаксимальными электрическими стимулами применяется последовательность из 8–10 стимулов и измеряются последовательные амплитуды и / или площади ответа. Это может выполняться при низкой (3–4 Гц) или высокочастотной стимуляции (20–50 Гц). В последнем случае последовательность удлиняется, чтобы можно было измерять непрерывные данные в течение 2–10 секунд. Как дистальные, так и проксимальные мышцы / нервы следует исследовать у каждого пациента, у которого есть подозрение на NMTD, поскольку таким образом значительно повышается чувствительность теста.

При низкочастотной стимуляции у нормальных субъектов амплитуда и / или площадь CMAP падает по сравнению с первыми 4–5 стимулами максимум на 10–12%. Максимальное падение должно быть между потенциалами 1 и 2 (см. Подводные камни RNS). Был опубликован ряд специальных протоколов для изучения RNS с течением времени как до, так и после периода максимального произвольного сокращения мышцы для выявления раннего или позднего отказа NMT (рис. 7).

Рисунок 7

(A) Нормальная повторяющаяся нервная стимуляция отводящей минимальной мышцы пальца руки.Амплитуда CMAP внутри каждой серии не уменьшается, и нет какого-либо значительного увеличения амплитуды CMAP после тренировки. (B) Повторяющаяся нервная стимуляция при миастении со стороны носовой мышцы. Даются четыре серии стимулов — все в исходном состоянии, без упражнений. Наблюдается воспроизводимое снижение на 55% (поезд 3 технически неудовлетворителен из-за артефакта движения).

Высокочастотная стимуляция может использоваться для обнаружения признаков постсинаптического расстройства высвобождения передатчика, такого как LEMS.Это болезненно и требует большой терпимости. Есть свидетельства того, что запись низкочастотного RNS непосредственно перед и после 20–30-секундного периода максимального произвольного сокращения пациентом одинаково чувствительна и более гуманна (рис. 8).

Рисунок 8

Эти следы показывают типичные электрофизиологические особенности пресинаптического нервно-мышечного нарушения передачи у пациента с LEMS. Кривые слева показывают небольшую амплитуду локтевого CMAP, которая после нагрузки увеличивается в четыре раза.Справа показаны повторяющиеся исследования нервной стимуляции. Амплитуда увеличивается после тренировки. Поезда 1, 3 и 4 показывают снижение на 30%, которое восстанавливается с помощью упражнений (поезд 2).

В тесте RNS есть много подводных камней, и артефакт почти всегда приводит к отклонению от нормы. Таким образом, соблюдение строгого протокола и повышенное подозрение со стороны CN к аномальному результату является важным, как и повторные исследования воспроизводимости аномалий (см. Подводные камни RNS).

Физиологическая основа RNS

Нервно-мышечное соединение состоит из терминала моторного аксона, синаптической щели и постсинаптической мышечной мембраны. По мере того как потенциал моторного аксона деполяризует нервное окончание, управляемые по напряжению кальциевые каналы открываются, увеличивая концентрацию кальция в пресинаптическом нервном окончании. Это, в свою очередь, способствует высвобождению квантов ацетилхолина (ACh) из нервного окончания в синаптическую щель. ACh связывается с рецепторами на постсинаптической мембране, вызывая деполяризацию (потенциал концевой пластинки).Размер потенциала концевой пластинки зависит от количества высвобождаемого ACh и его связывания с рецепторами. В здоровом состоянии потенциал концевой пластинки достигает порогового уровня и вызывает распространение потенциала действия по мышечному волокну, что приводит к сокращению мышц. Обычно существует большой коэффициент безопасности для нервно-мышечной передачи с количеством ACh, высвобождаемым за импульс несколько раз, что требуется для создания потенциала концевой пластинки порогового уровня.

При низкочастотном RNS скорость стимуляции такова, что физиология концевой пластинки подвергается стрессу, но не до уровня, который вызывает естественное облегчение NMT при более высоких частотах стимуляции.Таким образом, аномальное падение (декремент) амплитуды и / или площади CMAP при низких скоростях стимуляции указывает на снижение коэффициента безопасности для передачи по пре- или постсинаптической причине.

При высокочастотной стимуляции естественное облегчение усиливается пресинаптическим притоком Ca ++ , и это может противодействовать такому процессу, как LEMS, где квантовое высвобождение подавлено.

РНС при болезни

NMT-расстройства могут быть врожденными или приобретенными и в широком смысле могут рассматриваться как пресинаптические или постсинаптические, в зависимости от того, где находится дефект.

Постсинаптические нарушения передачи нервно-мышечного соединения

Архетипическим постсинаптическим расстройством является миастения (MG), при которой антитела к рецепторам ацетилхолина (AChR) вызывают деградацию и повышенный оборот рецептора, а также инициируемое макрофагами упрощение постсинаптической мембраны. В MG фактор безопасности теряется, потому что по мере истощения AChR происходит меньшая постсинаптическая деполяризация и некоторые потенциалы концевой пластинки не достигают порога для возникновения потенциала размноженной мышечной мембраны, вызывающего нервно-мышечный блок.Если этот процесс затрагивает значительную часть тестируемых концевых пластин мышц, базовая линия RNS покажет значительное снижение (более 10%). Декремент обычно измеряется путем сравнения амплитуды третьего или четвертого CMAP в поезде с первым (рис. 7B). Очень часто небольшое облегчение снижает декремент над потенциалами 7–10 поезда.

Ненормальный тест с уменьшающимся RNS неспецифичен и может наблюдаться в ряде обстоятельств, когда процессы сокращения мышц могут потерпеть неудачу при повторяющейся стимуляции (см. «Подводные камни» RNS).

Пресинаптические расстройства

В LEMS есть антитела к потенциалозависимым кальциевым каналам (пресинаптическое расстройство), вызывающие нарушение высвобождения квантов ACh. Низкочастотная стимуляция RNS может производить точно такой же декремент, как и в MG, с дополнительно небольшой начальной амплитудой CMAP. Здесь приток кальция в нервное окончание снижается из-за действия антител потенциал-управляемых кальциевых каналов, и, в свою очередь, высвобождение ACh в синаптическую щель снижается, и некоторые потенциалы концевой пластинки будут подпороговыми.

Однако диагностическая аномалия заключается в значительном увеличении амплитуды CMAP> 100% после физической нагрузки или быстрой повторяющейся стимуляции. Физические упражнения увеличивают приток кальция, и амплитуда CMAP может увеличиваться до 10 раз. В этом случае мы просто сравниваем амплитуду первого CMAP в поезде до и после тренировки (рис. 8). Несмотря на это приращение, внутри каждой низкочастотной последовательности может происходить дальнейшее снижение из-за истощения ACh.

ПОДВАЛ

Есть много ловушек, которые могут уловить неосторожных как при исполнении, так и при интерпретации NCS и RNS.Для удобства они разделены в таблицах 2 и 3. Технические ошибки, более подходящие для читателя, который является экспертом или обучающимся в CN, не включены.

Стол 2

Проведение испытаний

Стол 3

Устный перевод

ВЫВОДЫ

Исследования нервной проводимости в рамках ПНЭ являются продолжением истории болезни и обследования и важны при лечении черепно-мозговых и периферических нервно-мышечных заболеваний, а также способствуют диагностике поражений спинного мозга.NCS может быть чрезвычайно полезен как для локализации поражений, так и для определения ответственных патологических процессов. Мы перечислили многие подводные камни как для CN, выполняющих и интерпретирующих тесты, так и для лечащего врача. Для первых жизненно важно как точно и воспроизводимо проводить тесты, так и разработать стратегию исследования, основанную на симптомах и признаках пациента, а не на фиксированном протоколе. Затем исследователь должен четко сообщить о результатах, а затем поместить их в контекст клинической ситуации.

Для невролога или другого лечащего врача не менее важно, чтобы задаваемые клинические вопросы были ясными и отвечали на них, чтобы получить максимальную пользу от того, что может потребовать значительных затрат времени и навыков для исследователя и терпимости к дискомфорту пациента. Поэтому для наилучшего использования ограниченных ресурсов обучение и знание всех техник, подробно описанных в этой монографии, необходимы как часть общей неврологической тренировки.

ССЫЛКИ

  1. О SJ .Принципы клинической электромиографии. Балтимор: Lippincott Williams & Wilkins, 1998. ▸ Чрезвычайно удобочитаемая книга с прекрасными пояснительными разделами по методам нервной проводимости и множеством тематических исследований.

  2. Binnie C , Cooper R, Mauguière F, et al. Клиническая нейрофизиология Том 1 и 2, Elsevier 2004. ▸ Справочный текст, охватывающий все аспекты клинической нейрофизиологии, включая исследования нервной проводимости.В первую очередь нацелено на тех, кто занимается клинической нейрофизиологией.

  3. Кимура Дж. , Факты, заблуждения и др. Двадцать первая ежегодная лекция Эдварда Х. Ламберта. Мышцы и нервы 1997; 20: 777–87. ▸ Обзор основных методов, принципов и ошибок в исследованиях нервной проводимости. Отличное введение в исследования нервной проводимости.

  4. DeLisa JA , Lee HJ, Baran EM, et al. Руководство по скорости нервной проводимости и клинической нейрофизиологии. 3-е изд. Балтимор: Lippincott Williams & Wilkins, 1994. ▸ Линейные рисунки иллюстрируют, как на самом деле проводить большинство исследований нервной проводимости.

  5. Donofrio PD , Albers JW. Полинейропатия: классификация по исследованиям нервной проводимости и электромиографии. Мышцы и нервы 1990; 13: 889–903.

Новая модель седалищного нерва крысы — Mayo Clinic

TY — JOUR

T1 — Отсроченное восстановление периферического нерва

T2 — Новая модель седалищного нерва крысы

AU — Wu, Peng

AU — Spinner, Роберт Дж.

AU — Gu, Yudong

AU — Yaszemski, Michael J.

AU — Windebank, Anthony J.

AU — Wang, Huan

N1 — Информация о финансировании:
Это исследование спонсируется наградой Института регенеративной медицины Вооруженных сил США № W81XWH-08-2-0034. Отдел закупок медицинских исследований армии США, 820 Chandler Street, Fort Detrick, MD 21702-5014, является офисом по присуждению и администрированию закупок. Содержание рукописи не обязательно отражает позицию или политику правительства, и не следует делать вывод об официальном одобрении.Пэн Ву, доктор медицины, поддерживается стипендиальным фондом Sundt, отделением неврологической хирургии, клиники Мэйо. Авторы благодарят Джарреда Несбитта за помощь в уходе за животными и Дэвида Фактора медицинской иллюстрации за художественные работы.

PY — 2013/3

Y1 — 2013/3

N2 — Реконструкция периферического нерва редко проводится в острой фазе повреждения нерва из-за сопутствующих повреждений и неопределенности степени повреждения нерва. Правильная модель, имитирующая реальные клинические сценарии, крайне важна, но ее не хватает.Целью этого исследования является разработка стандартизированной модели отсроченного восстановления седалищного нерва у крыс и подтверждение возможности прямой вторичной нейроррафии после различных интервалов отсрочки. Сразу или через 1, 4, 6, 8 и 12 недель после перерезки седалищного нерва была проведена репарация нерва. Успешная прямая нейрография без напряжения (TFDN) была определена, когда разрыв был короче 4,0. мм, и культя может быть повторно аппроксимирована 10-0 стежками без отслоения. Составной потенциал мышечного действия (CMAP) регистрировали после операции.Зазоры между двумя культи нерва составляли от 0 до 9 мм, в среднем 1,36, 2,85, 3,43, 3,83 и 6,4. мм у крыс с задержкой 1, 4, 6, 8 и 12 недель соответственно. Общий процент успешных TFDN составил 78%. Значения CMAP для групп с задержкой на 1 и 4 недели не отличались от группы немедленного восстановления, тогда как амплитуды CMAP для групп с задержкой на 6, 8 и 12 недель были значительно ниже. Создана новая стандартизированная модель отсроченного восстановления нервов. Чтобы эта модель была чувствительной, интервал между повреждением нерва и вторичным восстановлением должен составлять не менее 4 недель.После этого, чем дольше задержка, тем сложнее модель регенерации нервов. Выбор интервалов задержки может быть адаптирован для удовлетворения конкретных требований будущих исследований.

AB — Реконструкция периферического нерва редко проводится в острой фазе повреждения нерва из-за сопутствующих повреждений и неопределенности степени повреждения нерва. Правильная модель, имитирующая реальные клинические сценарии, крайне важна, но ее не хватает. Целью этого исследования является разработка стандартизированной модели отсроченного восстановления седалищного нерва у крыс и подтверждение возможности прямой вторичной нейроррафии после различных интервалов отсрочки.Сразу или через 1, 4, 6, 8 и 12 недель после перерезки седалищного нерва была проведена репарация нерва. Успешная прямая нейрография без напряжения (TFDN) была определена, когда разрыв был короче 4,0. мм, и культя может быть повторно аппроксимирована 10-0 стежками без отслоения. Составной потенциал мышечного действия (CMAP) регистрировали после операции. Зазоры между двумя культи нерва составляли от 0 до 9 мм, в среднем 1,36, 2,85, 3,43, 3,83 и 6,4. мм у крыс с задержкой 1, 4, 6, 8 и 12 недель соответственно.Общий процент успешных TFDN составил 78%. Значения CMAP для групп с задержкой на 1 и 4 недели не отличались от группы немедленного восстановления, тогда как амплитуды CMAP для групп с задержкой на 6, 8 и 12 недель были значительно ниже. Создана новая стандартизированная модель отсроченного восстановления нервов. Чтобы эта модель была чувствительной, интервал между повреждением нерва и вторичным восстановлением должен составлять не менее 4 недель. После этого, чем дольше задержка, тем сложнее модель регенерации нервов. Выбор интервалов задержки может быть адаптирован для удовлетворения конкретных требований будущих исследований.

кВт — Модель животного

кВт — Задержка

кВт — Модель

кВт — Нерв

кВт — Вторичный ремонт

UR — http://www.scopus.com/inward/record.url?scp=84873185515&partner = 8YFLogxK

UR — http://www.scopus.com/inward/citedby.url?scp=84873185515&partnerID=8YFLogxK

U2 — 10.1016 / j.jneumeth.2013.01.003

DO — 10.1016th / j. 2013.01.003

M3 — Артикул

C2 — 23313757

AN — SCOPUS: 84873185515

VL — 214

SP — 37

EP — 44

JO — Journal of Neuroscience Methods 2 JOF

Методы

SN — 0165-0270

IS — 1

ER —

Механическое болевое поведение с отсроченным началом, вызванное травмой периферического нерва у младенцев, сопровождается симпатическим прорастанием в заднем ганглиях заднего корня

71

1248.Было доказано, что прорастание симпатического отростка в ганглии заднего корешка (DRG) после повреждения нерва вызывает нейропатическую боль у взрослых. Однако неясно, происходит ли аномальное прорастание при повреждении нерва у младенца. Методы . Перевязка спинномозгового нерва L5 (SNL) или фиктивная операция была выполнена взрослым крысам и 10-дневным детенышам, а механические пороги и тепловая гипералгезия были проанализированы на 3, 7, 14, 28 и 56 послеоперационных дней. Меченные тирозингидроксилазой симпатические волокна наблюдались в каждый момент времени, и были идентифицированы 2 рецептора нейротрофина (p75NTR и TrkA) для изучения механизмов симпатического разрастания. Результаты . У взрослых крыс, начиная с 3-го дня после операции, быстро развивалась механическая и тепловая гипералгезия с одновременным прорастанием симпатических клеток в DRG. Напротив, детеныши крыс не демонстрировали значительно более низкий механический порог до 28 дня после операции, когда симпатическое разрастание стало очевидным в DRG. Никакой тепловой гипералгезии у детенышей крыс не наблюдалось в любой момент времени. Выявлена ​​поздняя экспрессия глиального p75NTR в DRG крысят с 28 дня после операции, что было параллельно возникновению симпатического отростка.Экспрессия TrkA не показывала такого послеоперационного изменения синхронизации. Заключение . Механическая аллодиния с отсроченным началом в поражении нервов у младенцев сопровождалась параллельным прорастанием симпатической нервной системы в DRG. Поздняя параллельная экспрессия глиального повреждения p75NTR может играть важную роль в этом процессе, что дает новое понимание лечения замедленной подростковой нейропатической боли.

1. Введение

Невропатическая боль характеризуется спонтанной болью, аллодинией или гипералгезией и может быть быстро спровоцирована повреждением нерва у взрослых.Контроль над болью по-прежнему является сложной задачей, поскольку невропатическая боль после повреждения нерва у взрослых обычно плохо снимается традиционными фармакологическими методами лечения [1]. Популяционное когортное исследование показало, что люди среднего возраста, страдающие невропатической болью, чаще встречаются и достигают пика в возрасте от 70 до 79 лет [2]. Напротив, не было зарегистрировано никаких доказательств такой боли в младенчестве, и только очень немногие случаи были зарегистрированы в возрасте до 6 лет [3–5]. Например, отрыв плечевого сплетения может вызвать сильную невропатическую боль у 70% взрослых, которая практически не проявляется при рождении [4].Модели нейропатической боли на крысах продемонстрировали, что стойкая механическая аллодиния не исследовалась у детенышей крыс в течение 4 недель после операции [6]. Однако недавно сообщалось об отсроченном возникновении нейропатического болевого синдрома в позднем детстве и подростковом возрасте как следствие травмы нерва в раннем возрасте [5, 7]. Соответственно, гиперчувствительность к боли с отсроченным началом в подростковом возрасте наблюдалась также у животных с повреждением нервов в неонатальном периоде [8–12]. Поскольку у младенцев может развиваться ноцицепция и проявляться воспалительное болевое поведение, основной механизм этого отсроченного начала невропатической боли остается неизвестным.

Было продемонстрировано, что аберрантное разрастание симпатических волокон вокруг сомов нейронов в ганглиях задних корешков (DRG) после повреждения периферических нервов коррелирует с нейропатическим болевым поведением у взрослых [13–20]. Симпатические разрастающиеся волокна могут увеличивать экспрессию α -адренергических рецепторов, повышать возбудимость, вызывать спонтанную активность и изменять микросреду нейронов DRG [21–26]. Хирургическая симпатэктомия может облегчить механическую аллодинию, вызванную поражением спинномозгового нерва [27].Клинические исследования также подтвердили, что блокада симпатического нерва или внутривенная инфузия α -адренергических рецепторов, таких как фентоламин, может облегчить симптом поддерживаемой симпатической боли [28, 29]. Хотя симпатический отросток играет такую ​​важную роль в развитии боли, вызванной повреждением нерва, у взрослых, до сих пор неясно, связано ли это с повреждением нерва у младенцев.

В этом исследовании мы сравнили гистологические изменения в ипсилатеральном DRG после перевязки спинномозгового нерва L5 (SNL) детенышей крыс с таковыми у взрослых крыс, уделяя особое внимание послеоперационным временным изменениям симпатических разрастающихся волокон.Это исследование может дать новое понимание механизмов, лежащих в основе отсроченного начала невропатической боли при поражении нервов в неонатальном периоде.

2. Материалы и методы
2.1. Подготовка животных и хирургия

Эксперименты на животных проводили на крысах-самцах Sprague Dawley в возрасте 4 месяцев (с массой 250-300 г) или детенышах на 10-й день постнатального развития (с массой 22-26 г). Все протоколы были одобрены Комитетом по исследованиям на животных Шанхайского института Materia Medica Китайской академии наук.Все эксперименты на животных проводились в соответствии с руководством Национального института здравоохранения по уходу и использованию лабораторных животных (Публикации NIH № 8023, пересмотренные в 1978 г.). Животных содержали в контролируемых условиях температуры (° C), влажности (%) и 12-часового цикла свет / темнота. Взрослые крысы имели свободный доступ к стерильной пище и воде, а детенышей кормили их матери.

2.2. Хирургия

Операция по перевязке спинномозгового нерва L5 была выполнена всем взрослым крысам и детенышам под внутрибрюшинной анестезией 1% пентобарбиталом натрия (Shanghai Westang Bio-Tech Co., Шанхай, Китай, 50 мг / кг). Процедура хирургического вмешательства описана ранее Kim и Chung [30]. После препарирования кожи выполнен продольный разрез 5 мм латеральнее (слева) по средней линии от уровня L5 позвонка до первого крестцового позвонка. Паравертебральные мышцы были втянуты вместо удаления мышцы, как мы ранее вводили [31]. Спинной нерв L5 обнажали и лигировали до половины его диаметра шелковой нитью 6-0 (взрослые крысы) или 7-0 (детеныши), а затем разделяли на 5 мм дистальнее перевязки.Большое внимание было уделено тому, чтобы не повредить спинномозговой нерв L4. Имитацию контрольных животных как у взрослых крыс, так и у детенышей проводили идентично, за исключением того, что нервы не лигировали после воздействия спинномозгового нерва L5. Рана ушита шелковой нитью 4-0.

2.3. Поведенческий тест

Как для взрослых крыс, так и для детенышей было 6 крыс в фиктивной группе и 10 в группе SNL. Поведенческие тесты на механическую аллодинию и термическую гипералгезию проводили за 1 день до и через 3, 7, 14, 28 и 56 дней после операции.Все поведенческие тесты проводили 2 человека, которые не знали о группе.

2.4. Механическая Аллодиния

Порог механической абстиненции измерялся электронным анестезиометром фон Фрея (Ugo Basile, Италия). В тихой комнате каждую крысу помещали в прозрачный пластиковый ящик с дном из металлической сетки, подвешенным на 50 см над верхом лабораторного стола, что позволяло провести 20 минут поведенческой акклиматизации. Электронный полипропиленовый наконечник фон Фрея накладывали перпендикулярно средней подошвенной поверхности задней лапы с наклонным зеркалом под решеткой, чтобы обеспечить четкий обзор лапы [32].Пороговое давление автоматически регистрировалось при отдергивании лапы с последующим отчетливым вздрагиванием [33]. Каждый эксперимент повторяли 3 раза с 5-минутными интервалами. Среднее значение рассчитывалось как порог механического изъятия.

2,5. Тепловая гипералгезия

Тепловую гипералгезию измеряли по задержке отдергивания лапы. Подошвенную сторону задней лапы помещали на поверхность горячей пластины (YLS-12A, Shanghai Precision Instruments Co., 50 ° C) после акклиматизации взрослых крыс или детенышей к поведенческому аппарату [34, 35].Величину задержки отдергивания лапы из-за теплового раздражителя регистрировали вручную с помощью хронометра. Учитывалось только явное одностороннее отдергивание лапы. Каждый эксперимент по измерению задержки теплового вывода повторяли трижды с 10-минутными интервалами. Среднее значение считалось задержкой теплового вывода.

2.6. Иммуногистохимическое окрашивание DRG

Сорок крысят или взрослых крысят случайным образом разделили на фиктивную контрольную () и группу L5 SNL (). На 3, 7, 14, 28 и 56 день после операции 5 крысам из группы SNL и 3 из группы фиктивного контроля перфузировали 4% параформальдегид для иммуногистохимического окрашивания DRG.Образцы разрезали на срезы ткани толщиной 7 мкм, мкм, используя криостат, и собирали на предметных стеклах для иммуногистохимии или иммунофлуоресценции.

Срезы образцов блокировали в 5% нормальной ослиной сыворотке, которую разбавляли 0,3% буфером Triton X-100 PBS в течение 2 часов, а затем инкубировали в поликлональных первичных антителах к тирозингидроксилазе (TH) (Pel-Freez, 1: 1000). разведение) при 4 ° C в течение 48 часов. После нескольких промываний срезы тканей дополнительно исследовали биотинилированными вторичными антителами (Chemicon, разведение 1: 200) в течение 2 часов, а затем реагентами ABC (Beyotime, разведение 1: 500) в течение 30 минут, нанося DAB на каждый срез для окрашивания и погружения в ddH 2 O при достижении приемлемой интенсивности окрашивания и, наконец, обезвоживание срезов и их закрытие покровными стеклами.Для двойного иммунофлуоресцентного окрашивания криосрезы блокировали в PBS, содержащем 5% нормальной ослиной сыворотки, в течение 2 часов при комнатной температуре. Срезы инкубировали в течение ночи при 4 ° C с первичными антителами против GFAP, NF200 (мышиное моноклональное антитело против нейрофиламентов 200 кДа, 1:50, Chemicon) и CGRP (кроличье антитело против пептида, связанного с геном кальцитонина, 1: 2000, Сигма). После 3-кратной промывки PBS срезы инкубировали в течение 1 ч при комнатной температуре с меченными Alexa Fluor 488 ослиными анти-кроличьими IgG (1: 400, Life Technologies) и меченными Alexa Fluor 594 ослиными антимышиными IgG (1 : 400, Life Technologies).Срезы промывали 3 раза в PBS с последующим закреплением ткани установочной средой Dako Fluorescence Mounting Medium.

Поскольку считается, что разрастание постганглионарных симпатических волокон в DRG индуцируется нейротрофином, мы также обнаружили распределение двух типов мембранных рецепторов нейротрофина: низкоаффинного рецептора p75 (p75NTR) и высокоаффинного рецептора тропомиозин-родственной киназы А. (Трка). Срезы инкубировали с первичными антителами против p75 (кроличьи антитела против p75 рецептора NGF, 1:50, Abcam) или TrkA (кроличьи антитела против TrkA, 1: 1000, Abcam).После 3-кратной промывки PBS срезы инкубировали в течение 1 ч при комнатной температуре с меченным Alexa Fluor 594 ослиным анти-кроличьим IgG (1: 400, Life technologies).

2.7. Количественное определение TH-IR-волокон

Шесть L5 DRG-срезов на образец в каждый момент времени окрашивали для подсчета TH-IR (иммунореактивных) волокон. Подробности описаны ранее [36, 37]. Изображения срезов DRG были разделены на область, сконцентрированную на теле клетки, и область, сфокусированную на аксоне TH-IR. Для взрослых крыс были случайным образом взяты 4 микрофотографии области тела клетки и 2 области аксона для каждого образца при 200-кратном увеличении.Длину волокон TH-IR измеряли с помощью программы анализа изображений NIH Image. Мы считали только видимые волокна; волокна на кровеносных сосудах или косой разрез исключены. Для детенышей крыс были отобраны микрофотографии при 400-кратном увеличении срезов, полученных до 28 дня после операции; срезы с 28 по 56 день проводились так же с взрослыми крысами.

2,8. Статистический анализ

Статистический анализ выполняли с использованием программного обеспечения SPSS 22.0 (IBM, Армонк, Нью-Йорк, США). -тест и ANOVA с последующим тестом LSD были использованы для сравнения параметров поведения между двумя группами и между разными временными точками после операции.-тест также проводился для анализа различий в плотности симпатических нервных волокон между хирургической группой и имитационной группой. считался статистически значимым.

3. Результаты

Операция по L5 SNL вызывает механическую аллодинию с отсроченным началом у детенышей крыс.

Операция L5 SNL у взрослых крыс вызывает резкое и статистически значимое снижение порога механического отрыва и теплового латентного периода на ипсилатеральной задней лапе с 3-го дня после операции и сохраняется до 56-го дня (рисунки 1 (a) и 1 (b)).Напротив, механический порог у крысят не показывает разницы по сравнению с таковым у фиктивных контрольных животных до 28 дня после операции, хотя значения постепенно увеличиваются со временем после операции. Начиная с 28-го дня, порог механического вывода групп SNL у детенышей крыс начинает быть значительно ниже, чем у фиктивных групп, что указывает на развитие механической аллодинии с отсроченным началом (рис. 1 (c)). Никаких существенных различий в латентном периоде теплового вывода у детенышей крыс в каждой послеоперационной временной точке между двумя группами не наблюдается (рис. 1 (d)).

Симпатические прорастающие волокна имеют сходный временной ход с развитием механической аллодинии после L5 SNL у детенышей.

У взрослых крыс плотность симпатических волокон TH-IR в L5 DRG постепенно увеличивается, начиная с 3-го послеоперационного дня, и сохраняется на высоком уровне с 14-го по 56-й день. Прорастающие волокна широко распределяются как в клеточной, так и в аксональной областях DRG. Некоторые волокна образуют кольцевые структуры вокруг нейронов. В любой момент времени после SNL L5 взрослого человека плотность TH-IR волокон в L5 DRG животных SNL значительно выше, чем в группе ложной хирургии, в которой прорастающие волокна обнаруживаются лишь изредка, а кольцеобразная структура отсутствует. наблюдается (рис. 2 (а)).

У детенышей TH-IR волокна очень редки в течение 14 дней после операции. С 28 дней прорастающие волокна начинают существенно увеличиваться во всей области DRG, некоторые из которых также образуют кольцеобразные структуры вокруг нейронов, и сохраняются до 56 дня (Рисунок 2 (b)).

Двойное иммунофлуоресцентное окрашивание подтверждает, что кольца TH-IR обычно образуются вокруг первичных афферентных нейронов, экспрессирующих CGRP (Рисунок 3) или NF-200 (Рисунок 4) как у взрослых крыс, так и у детенышей крыс.


3.1. p75NTR Expression

Недавние исследования показали, что рецепторы нейротрофина, которые в основном экспрессируются в сателлитных глиальных клетках (SGCs) после повреждения нерва, играют важную роль в развитии симпатического отростка [38-40]. Таким образом, мы оценили экспрессию низкоаффинного рецептора p75NTR и высокоаффинного рецептора TrkA в ипсилатеральных нейронах L5 DRG. Как правило, p75NTR распределяется только в цитоплазме нейронов в DRG взрослых и детенышей крыс.Повреждения нервов у взрослых вызывают образование колец из астроцитов, которые в высокой степени экспрессируют оба рецептора, начиная с ранней послеоперационной стадии (рис. 5 (а)). Напротив, травмы нервов у младенцев не вызывают увеличения глиальной части p75NTR-IR вокруг нейронов в течение 28 дней после операции. Также наблюдается высокая экспрессия p75NTR в ядерной оболочке (Рисунки 5 (b) и 5 ​​(c)). . Начиная с 28-го дня у детенышей крыс также наблюдалось отсроченное появление глиальных колец p75NTR-IR, что параллельно возникновению механической гипералгезии.Повреждение нерва у младенцев не индуцировало высокую экспрессию TrkA в глиальном кольце в любой послеоперационный момент времени (дополнительный рисунок 1).

4. Обсуждение

В этом исследовании мы сравнили долгосрочные последствия L5 SNL на болевое поведение между младенцами и взрослыми крысами. В отличие от быстрого развития болевого поведения у взрослых детенышей механической аллодинии не наблюдалось до 28 дней после повреждения нерва. Порог механической абстиненции неуклонно повышался по мере постнатального развития, как описано ранее [6, 41].Таким образом, реальные послеоперационные изменения механического порога у детенышей смешиваются со снижением порога, вызванным операцией, и нормальным развитием. Чтобы преодолеть эту проблему, мы сравнили измерения между SNL и фиктивными группами в каждый момент времени, чтобы определить реальный эффект операции на болевое поведение. Однако с 28-го дня после операции подъем на травмированной стороне замедлился, при этом пороговое значение было значительно ниже, чем у фиктивного контроля, что позволяет предположить, что у детенышей возникла механическая болевая чувствительность.Никаких различий в величине теплового латентного периода между двумя группами в какие-либо послеоперационные моменты времени у детенышей не наблюдалось, что позволяет предположить, что повреждение нервов в раннем возрасте оказывает специфическое влияние на механическую ноцицепцию у подростков. В модели защищенного нервного повреждения (SNI) у новорожденных крыс на 21 день после операции развивалось механическое, но не тепловое болевое поведение [10, 12]. Однако, в отличие от двух вышеупомянутых моделей, поражение нервов, иннервирующих хвост, у детенышей вызывало менее стойкую механическую и холодовую аллодинию через 6-8 недель после операции [11].Различные характеристики болевого поведения можно отнести к типу повреждения нерва. В этом исследовании механическая аллодиния с отсроченным началом у детенышей с L5 SNL может предоставить возможность для дальнейшего изучения механизмов, участвующих в развитии нейропатической боли.

Симпатическое разрастающееся волокно в DRG было описано как важное событие, участвующее в развитии нейропатической боли после L5 SNL после повреждения нерва у взрослых [16, 19, 20]. Прорастающие волокна преимущественно образуют гнезда с синапсоподобными структурами вокруг спонтанно активных нейронов или сцепляются с эфферентными волокнами [18, 42].Было доказано, что количество прорастающих волокон статистически коррелирует с нейропатическим поведением [16, 43]. Было доказано, что синапсоподобные структуры, образованные симпатическими волокнами и дендритами, способствуют поддержанию состояния хронической боли [18]. Уменьшение отрастания, вызванное ранней блокадой волокон, снижает спонтанную активность нейронов DRG и снижает болевое поведение [43–45]. Все предыдущие результаты были получены на моделях нейропатической боли у взрослых. В этом исследовании детеныши показали более высокую плотность симпатических волокон, чем имитация контроля, через 28 дней после операции.Насколько нам известно, это первый случай продемонстрировать отсроченное начало симпатического отростка в DRG моделей животных с ранним поражением нервов. Плотность прорастающих волокон в подростковом периоде, хотя и не такая высокая, как у взрослых крыс, значительно увеличилась по сравнению с фиктивным контролем. Ход времени параллелен возникновению механической аллодинии у детенышей. Эти результаты предполагают, что отсроченное прорастание симпатических волокон может быть связано с наличием невропатической боли в подростковом возрасте в случае повреждения нервов в младенчестве и детстве.В последнее время все больше исследований было направлено на уменьшение разрастания симпатических волокон для облегчения симптома невропатической боли. Доказано, что дексмедетомидин, избирательно сильный агонист 2-адренорецептора α , облегчает нейропатическую боль за счет уменьшения симпатического отростка. Будущие исследования, нацеленные на механизм блокирования симпатического разрастания, могут предоставить новую терапевтическую стратегию в предотвращении или лечении отсроченной нейропатической боли в подростковом возрасте после повреждения нерва на ранней стадии.

Чтобы определить возможные механизмы, связанные с отсутствием раннего симпатического прорастания у детенышей, мы провели серию сравнительных иммуногистохимических и иммунофлуоресцентных анализов между взрослыми крысами и детенышами, включая SGC (глиальный фибриллярный кислый белок) (дополнительный рисунок 2), макрофаги. (OX-42, главный комплекс гистосовместимости-II), фактор роста нервов (дополнительные рисунки 3 и 4) и рецепторы нейротрофина (p75NTR, TrkA). Только распределение глиального p75NTR показало достоверную разницу между двумя возрастными группами в раннем послеоперационном периоде.Уровень нейротрофинов играет решающую роль в прорастании симпатических нервов, а также в возникновении нейропатической боли [37, 46]. После повреждения нерва у взрослых повышается синтез нейротрофинов в SGCs, окружающих поврежденные нейроны, которые активируют рецепторы p75NTR или Trk, вызывая нейропатическую боль [38, 47–50]. Было подтверждено, что как рецептор нейротрофина с низким сродством, p75NTR необходим для симпатического разрастания, вызванного повышенными уровнями нейротрофинов [40]. Нокаут гена может значительно уменьшить симпатическое разрастание после повреждения нерва, что подтвердило причинную связь между нейротрофинами, p75NTR и симпатическим разрастанием при повреждениях нервов у взрослых [51, 52].В этом исследовании мы наблюдали отсроченную высокую экспрессию глии p75NTR вокруг нейронов через 28 дней после повреждения нерва у младенца, и это изменение точно параллельно началу симпатического отростка. Результаты предполагают, что механизм, с помощью которого задерживается симпатическое разрастание, может относиться к позднему увеличению экспрессии p75NTR вокруг нейронов после повреждения нерва на ранней постнатальной стадии. Наблюдалось, что астроциты зрительной коры головного мозга кошек приобретают зрелый звездчатый вид между третьей и седьмой неделями после рождения [53].Рецепторы, регулирующие коммуникацию нейрон-SGC, также показали очевидные постнатальные изменения в DRG [54]. Мы предполагаем, что раннее отсутствие экспрессии p75NTR может быть связано с незрелостью SGCs и отличными от взрослых связей между нейронами и SGC. По мере созревания SGC экспрессия p75NTR постепенно увеличивается, и симпатические аксоны привлекаются для прорастания к нейронам. Отсутствие параллельного увеличения экспрессии рецептора TrkA предполагает, что TrkA не может напрямую способствовать развитию механической аллодинии при поражении нервов у младенцев.Эти результаты могут дать представление об открытии новых способов улучшения профилактического или терапевтического воздействия на нейропатическую боль с отсроченным началом после раннего периода повреждения нерва. Например, ингибиторы p75NTR могут быть разработаны для избирательного блокирования передачи сигналов нейротрофина, чтобы снизить риск нейропатической боли в подростковом возрасте.

В заключение, мы показали отсроченное начало механической аллодинии у младенца после операции L5 SNL, сопровождающееся симпатическим прорастанием в DRG.Отсроченная экспрессия глиального p75NTR может играть важную роль при наличии симпатического разрастания, а также при невропатической боли. Дальнейшие исследования механизмов, лежащих в основе взаимосвязи между p75NTR и симпатическим отростком у младенца, могут предоставить новую терапевтическую стратегию в лечении невропатической боли.

Доступность данных

Данные, использованные для подтверждения результатов этого исследования, включены в статью и дополнительные информационные файлы.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов в отношении публикации этой статьи.

Вклад авторов

Пей Лю и Цин Чжан внесли равный вклад в эту работу.

Благодарности

Финансовая поддержка этого исследования была предоставлена ​​Национальным фондом естественных наук Китая (81101398).

Дополнительные материалы

Дополнительный рисунок 1: кольца глиальных клеток, экспрессирующие TrkA, представлены вокруг нейронов DRG у взрослых крыс (а), но не у детенышей на 7 день после операции (б).Сплошные стрелки — кольца глиальных клеток, экспрессирующие TrkA. Масштабные линейки, 100 мкм м. Дополнительный рисунок 2: иммунофлуоресцентное окрашивание для GFAP ганглия дорсального корешка через 3 дня после L5 SNL у взрослых (а) и детенышей крыс (б). Вокруг нейронов обеих групп, в основном крупных, были активированные сателлитные глиальные клетки GFAP (+) (стрелки). Дополнительный рисунок 3: двойное окрашивание на NGF (красный) и MHCII (зеленый) ганглия дорсального корешка через 7 дней после L5 SNL у взрослых (а) и детенышей крыс (б). Обе группы показали инфильтрацию макрофагов MHCII (+) (стрелки), окружающих нейроны.Дополнительный рисунок 4: иммуногистохимическое окрашивание на OX-42 ганглия дорсального корешка через 7 дней после L5 SNL у взрослых (а) и детенышей крыс (б). Обе группы показали инфильтрацию макрофагов OX-42 (+) (стрелки), окружающих нейроны. (Дополнительные материалы)

Не откладывайте лечение синдрома запястного канала

Игнорирование симптомов синдрома запястного канала может привести к необратимому повреждению нервов.

Во-первых, вы можете заметить покалывание или онемение в пальцах, которое приходит и уходит.Со временем ощущения могут ухудшиться, длиться дольше или даже разбудить вас по ночам. В конце концов, боль и онемение могут даже затруднить захват таких вещей, как вилка, ручка или другие предметы.

Если у вас есть эти симптомы, это может быть синдром запястного канала, который возникает, когда срединный нерв, идущий вниз по руке в руку, сжимается связкой, пересекающей его, когда он проходит через узкое пространство в руке. запястье, известное как запястный канал.

«Синдром запястного канала имеет классические симптомы, которые включают онемение и покалывание в большом, указательном пальце, среднем пальце и половине безымянного пальца», — говорит д-р.Тамара Розенталь, профессор ортопедической хирургии в Гарвардской медицинской школе и руководитель отделения хирургии кисти и верхних конечностей в Медицинском центре Бет Исраэль Дьяконесса. Ваш мизинец обычно не поражается, потому что его обслуживает другой нерв.

Женщины в группе риска

Женщины более склонны к синдрому запястного канала из-за факторов риска, таких как беременность, специфичных для их пола. К другим факторам риска относятся:

  • сахарный диабет
  • кисты, которые вторгаются в канал запястного канала
  • распитие спирта
  • лишний вес
  • заболевание щитовидной железы
  • артрит запястья.

Раньше считалось, что повторяющиеся действия, такие как нажатие на клавиатуру, могут вызвать синдром запястного канала, однако исследования показали, что в основном это не так, говорит доктор Розенталь. Однако регулярное использование тяжелого или вибрирующего оборудования, такого как отбойный молоток, может предрасположить вас к этому состоянию.

Диагностика

Ваш врач обычно может диагностировать синдром запястного канала на основе ваших симптомов и результатов физикального обследования. Но в некоторых случаях вам могут потребоваться дополнительные тесты, чтобы убедиться, что эти симптомы не вызваны другим заболеванием, таким как артрит, защемление нерва на шее или невропатия (нервное заболевание, которое может быть осложнением диабета или других состояний. ), — говорит д-р.Розенталь.

Один из тестов, используемых для подтверждения синдрома запястного канала, исследование нервной проводимости и электромиограмма (ЭМГ), использует электрический сигнал, чтобы определить, насколько хорошо работает нерв. В другом тесте используется ультразвук, который менее инвазивен, чем ЭМГ, но требует наличия опытного специалиста и не так широко доступен.

Лечение синдрома запястного канала

В легких случаях синдрома запястного канала отдых руки и ношение шины на ночь может быть всем, что нужно для облегчения симптомов.По словам доктора Розенталя, симптомы синдрома запястного канала часто возникают ночью, заставляя людей просыпаться и трястись или двигать рукой, пока онемение не исчезнет и не станет лучше. Лекарства, такие как аспирин и ибупрофен, не являются лекарством, но могут облегчить боль. Ваш врач может также попробовать сделать вам инъекции стероидов, чтобы облегчить симптомы.

Если эти методы лечения запястного канала неэффективны, возможно, пришло время подумать об операции по освобождению связки, которая оказывает давление на срединный нерв.

Когда обращаться за помощью

«Ошибка, которую часто совершают люди, — это слишком долгое ожидание перед операцией», — говорит доктор Розенталь. «Я вижу много людей, которые говорят, что их онемение постепенно ухудшалось, и теперь их рука полностью онемела уже год». По ее словам, если нерв сжимается достаточно долго, мышца атрофируется, и повреждение нерва становится необратимым.

Итак, если симптомы запястного канала не поддаются лечению другими методами, примите меры.

Операция под местной анестезией длится 10 минут. «Если вы не выполняете работу, связанную с ручным трудом, вы, как правило, можете вернуться к нормальной деятельности», — говорит доктор Розенталь.

«Я все время говорю своим пациентам, что освобождение запястного канала, сделанное в нужное время для постановки правильного диагноза, очень успешно», — говорит она.

Изображение: © Daisy-Daisy / Getty Images

Поделиться страницей:

Заявление об ограничении ответственности:
В качестве услуги для наших читателей Harvard Health Publishing предоставляет доступ к нашей библиотеке заархивированного содержимого.Обратите внимание на дату последнего обзора или обновления всех статей. Никакой контент на этом сайте, независимо от даты, никогда не должен использоваться вместо прямого медицинского совета вашего врача или другого квалифицированного клинициста.

Задержка созревания блуждающего нерва при синдроме внезапной детской смерти

  • 1.

    Армстронг Д., Сашис П., Брайан С., Беккер Л. (1982) Патологические особенности стойкого инфантильного апноэ во сне в связи с патологией синдрома внезапной детской смерти.Энн Нейрол 12: 169–174

    Google Scholar

  • 2.

    Асала С.А., Бауэр А.Дж. (1986) Исследование состава блуждающего нерва хорька с помощью электронного микроскопа. Анат Амбриоль (Берл) 175: 247–253

    Google Scholar

  • 3.

    Becker LE (1984) Невропатологические основы респираторной дисфункции при синдроме внезапной детской смерти. In: Tildon JT, Roeder LM, Steinschneider A (es) Синдром внезапной детской смерти.Academic Press, New York, pp 99–114

    Google Scholar

  • 4.

    Becker LE (1990) Задержка созревания нейронов как звено в цепи событий, ведущих к СВДС. Can J Neurol Sci 17: 361–371

    Google Scholar

  • 5.

    Брюс К., Беккер Л. Е. (1991–92) Количественное определение медуллярного астроглиоза при синдроме внезапной детской смерти. Педиатр Нейрохирург 17: 74–79

    Google Scholar

  • 6.

    Daly M. de B, Evans DHL (1953) Функциональные и гистологические изменения блуждающего нерва кошки после дегенеративного разреза на различных уровнях. J Physiol (Lond) 120: 579–595

    Google Scholar

  • 7.

    De Neef KJ, Jansen JR, Versprille A (1982) Морфология развития и физиология блуждающего нерва кролика. Brain Res 256: 265–274

    Google Scholar

  • 8.

    Feldman JL, McCrimmon DR, Smith JC, Ellenberger HH, Speck DF (1986) Генерация респираторного паттерна у млекопитающих.В: фон Эйлер С, Лангеркранц Х (ред.) Нейробиология контроля дыхания. Raven Press, New York, pp 157–164

    Google Scholar

  • 9.

    Ferriere G, Denef JF, Rodriguez J, Guzzetta F (1985) Морфометрические исследования нормальных икроножных нервов у детей. Мышечный нерв 8: 697–704

    Google Scholar

  • 10.

    Filiano JJ, Kinney HC (1992) Дугообразная гипоплазия ядра при синдроме внезапной детской смерти.J Neuropathol Exp Neurol 51: 394–403

    Google Scholar

  • 11.

    Guo Y-P, McLeod JG, Baverstock J (1987) Патологические изменения блуждающего нерва при диабете и хроническом алкоголизме. J Neurol Neurosurg Psychiatry 50: 1449–1453

    Google Scholar

  • 12.

    Jenq CB, Chung K, Coggeshall RE (1986) Постнатальная потеря аксонов в нормальном седалищном нерве крысы. J Comp Neurol 244: 445–450

    Google Scholar

  • 13.

    Kinney HC, Brody BA, Finkelstein DM, Vawter GF, Mandell F, Gilles FH (1991) Задержка миелинизации центральной нервной системы при синдроме внезапной детской смерти. J Neuropathol Exp Neurol 50: 29–48

    Google Scholar

  • 14.

    Krous HF, Jordan J, Wen J, Farber JP (1985) Морфометрия развития блуждающего нерва в опоссуме. Brain Res 352: 155–159

    Google Scholar

  • 15.

    Mei N, Condamin M, Boyer A (1980) Состав блуждающего нерва кошки. Cell Tissue Res 209: 423–431

    Google Scholar

  • 16.

    Naeye RL, Ladis B, Drage JS (1976) Синдром внезапной детской смерти. Перспективное исследование. Am J Dis Child 130: 1207–1210

    Google Scholar

  • 17.

    Pereyra PM, Zhang W, Schmidt M, Becker LE (1992) Развитие миелинизированных и немиелинизированных волокон блуждающего нерва человека в течение первого года жизни.J Neurol Sci 10: 107–113

    Google Scholar

  • 18.

    Perrin DG, Cutz E, Becker LE, Bryan AC, Madapallimatum A, Sole MJ (1984) Синдром внезапной детской смерти: повышенное содержание дофамина в сонных артериях и норадреналина. Ланцет II: 535–537

    Google Scholar

  • 19.

    Quattrochi JJ, McBride PT, Yates AAJ (1985) Незрелость ствола мозга при синдроме внезапной детской смерти: количественное быстрое исследование Гольджи дендритных шипов у 95 младенцев.Brain Res 325; 39–48

    Google Scholar

  • 20.

    Rognum TO, Saugstad OD, Øyasæter S, Olaisen B (1988) Повышенные уровни гипоксантина в стекловидном теле указывают на длительную церебральную гипоксию у жертв синдрома внезапной детской смерти. Педиатрия 82: 615–618

    Google Scholar

  • 21.

    Sachis PN, Armstrong DL, Becker LE, Bryan AC (1981) Блуждающий нерв и синдром внезапной детской смерти: морфометрическое исследование.J Pediatr 98: 278–280

    Google Scholar

  • 22.

    Sachis PN, Armstrong DL, Becker LE, Bryan AC (1982) Миелинизация блуждающего нерва человека с 24 недель после зачатия до подросткового возраста. J Neuropathol Exp Neurol. 41: 466–472

    Google Scholar

  • 23.

    Schäfer K, Friede RL (1988) Начало и скорость миелинизации в шести периферических и вегетативных нервах крысы.J Anat 159: 181–195

    Google Scholar

  • 24.

    Schröder JM, Bohl J, Brodda K (1978) Изменения в соотношении между толщиной миелина и диаметром аксона в развивающемся икроножном нерве человека. Acta Neuropathol (Berl) 43: 169–178

    Google Scholar

  • 25.

    Schröder JM, Bohl J, von Bardeleben U (1988) Изменения соотношения между толщиной миелина и диаметром аксона в развивающихся икроножных, бедренных, локтевых, лицевых и блокадных нервах.Acta Neuropathol 76: 471–483

    Google Scholar

  • 26.

    Siebert JR, Haas JE (1991) Увеличение языка при синдроме внезапной детской смерти. Педиатр Патол 11: 813–826

    Google Scholar

  • 27.

    Steinschneider A (1977) Ринофарингит и синдром внезапной детской смерти. Педиатрия 60: 531–533

    Google Scholar

  • 28.

    Takashima S, Becker LE (1985) Аномалии развития медуллярных «дыхательных центров» при синдроме внезапной детской смерти. Exp Neurol 90: 580–587

    Google Scholar

  • 29.

    Takashima S, Becker LE (1991) Задержка дендритного развития катехоламинергических нейронов в вентролатеральном мозговом веществе детей, умерших от синдрома внезапной детской смерти. Нейропедиатрия 22: 97–99

    Google Scholar

  • 30.

    Takashima S, Armstrong D, Becker L, Bryan C (1978) Церебральная гипоперфузия при синдроме внезапной детской смерти? Глиоз ствола головного мозга и сосудистая сеть. Энн Нейрол 4: 257–262

    Google Scholar

  • 31.

    Takashima S, Armstrong D, Becker LE, Huber J (1978) Поражения белого вещества головного мозга при синдроме внезапной детской смерти. Педиатрия 62: 155–159

    Google Scholar

  • 32.

    Takashima S, Mito T, Becker LE (1985) Развитие нейронов в ретикулярной формации мозгового вещества при синдроме внезапной детской смерти и недоношенных младенцев.Нейропедиатрия 16: 76–79

    Google Scholar

  • 33.

    Тонкин С. (1983) Обструкция дыхательных путей глотки: физические признаки и факторы, влияющие на ее возникновение. В: Tildon JT, Roeder LM, Steinschneider A (eds) Синдром внезапной детской смерти. Academic Press, New York, pp 453–465

    Google Scholar

  • 34.
  • Добавить комментарий

    Ваш адрес email не будет опубликован.

    © Женский журнал 2022 Все права закотяшены