Диеты 5п: Диета № 5П (Щадящая диета)

Содержание

Диета № 5П (Щадящая диета)

Рекомендуемые продукты и блюда Исключаемые продукты и блюда
Хлеб пшеничный из муки 1-го и 2-го сорта
подсушенный или вчерашний, в виде сухарей,
несладкое сухое печенье
Ржаной и свежий хлеб, изделия из сдобного и слоеного теста
Супы вегетарианские и протертые с картофелем, морковью, кабачками,тыквой, овсяной, гречневой
крупами, рисом, вермишелью. Добавляют 5 г сливочного масла или 10 г сметаны
Супы на мясном, рыбном бульоне, отваре грибов и овощей, с пшеном, молочные супы, борщ, щи, холодные (окрошка, свекольник)
Нежирных сортов говядина, телятина, кролик, курица, индейка, птица без кожи.
В отварном или паровом виде, протертое, рубленое(котлеты, кнели, пюре, суфле и др.).
Нежирные цыплята, кролик, телятина — куском, отварные.
Жирные сорта мяса животных и птиц (утки, гуся), жареное, тушеное, печень, мозги, почки, колбасы, консервы, копчености
Нежирная в отварном виде, куском и рубленая. Заливная после отваривания. Жирные виды рыб, жареная и тушеная, копченая и соленая рыба, консервы, икру
Молочные продукты преимущественно пониженной
жирности.Свежий некислый творог 9% жирности и нежирный, кальцинированный в натуральном виде, паста, паровые и запеченные пудинги.
Молоко при переносимости. Кисломолочные напитки. Сметана и сливки — в блюда, неострый, нежирный сыр
Молочные продукты повышенной жирности и с включением сахара
Белковый омлет из 2 яиц, желтки — ограниченно (до 1/2 в день) в блюда Яйца, сваренные вкрутую и жареные, блюда из цельных яиц
Протертые и полувязкие каши из овсяной, гречневой, манной крупы, риса, сваренные на воде или пополам с молоком. Крупяные суфле, пудинги
с творогом, запеканки, макаронные изделия
Бобовые, рассыпчатые каши, ограничивают — перловую, ячневую, кукурузную крупу, пшено
Овощи отварные и запеченные в протертом виде. Картофель, морковь, цветная капуста, свекла, кабачки, тыква, зеленые горошек Репа, редька, редис, белокочанная капуста, щавель, шпинат, лук, чеснок, перец сладкий, грибы
Закуски исключают
Спелые, мягкие, некислые фрукты и ягоды, протертые сырые, запеченные яблоки,
желе, муссы с заменителями сахара или
полусладкие на сахаре
Шоколад, варенье, мороженое, сырые не протертые фрукты и ягоды, виноград, финики, инжир, бананы, кондитерские изделия
Молочные, на некрепком овощном отваре соусы, фруктово-ягодные полусладкие подливки, муку не пассируют Соусы на мясном, рыбном, грибном бульонах, томатный соус, все пряности
Слабый чай с лимоном, полусладкий с молоком, отвар шиповника, фруктово-ягодные соки без сахара Какао, кофе, газированные и холодные напитки, виноградный сок
Сливочное масло (30 г), рафинированные растительные масла (10-15 г) в блюда Другие жиры

Диета №5п или стол №5п – меню стола 5п на неделю по показаниям, разрешенные и запрещенные продукты, отзывы и результаты

Содержание статьи:

Лечебный стол номер 5п применяется для назначения при острых/хронических панкреатитах, как на стадии обострения, так и вне ее – на стадии ремиссии.

Основные отличия данной диеты – в низкой калорийности блюд, ограничении животных белков и углеводов с жирами, с исключением определенных продуктов и включении в рацион богатой на витамины/минералы пищи.

Режим питания на панкреатической диете №5п

Принципы диеты №5п:

Ограничивают: соль – до 10 г/сутки, жидкости – до 2 л/сутки, эфирные масла, грубую клетчатку.

Исключают: все продукты, способные вызвать вздутие кишечника, продукты с грубой клетчаткой, а также пищу, которая приводит к усилению секреции пищеварительных соков, и жареную пищу.

Как готовить? Все блюда готовят исключительно на пару или отваривают. Также можно запекать. Пища, в первую очередь, должна быть полноценной и сбалансированной относительно состава минералов и витаминов, полужидкой, теплой.

Цель стола №5п – нормализовать работу поджелудочной, защитить желудок и ЖКТ от раздражителей, снизить возбудимость желчного пузыря, защитить печень.
Питание (в день) — 5-6-разовое.

Разрешенные продукты

Продукты, которые рекомендованы и разрешены для употребления:

  • Вчерашний хлеб (мука 1-2 сорта), сухое печенье (несладкое)
  • Супы из овощей и круп. Крупы протирают. Из разрешенных – греча и рис, манка и овсянка, вермишель. Овощные ингредиенты – тыква с морковкой, кабачки, картофель. Для заправки – 10 г сметаны либо 5 г масла. Зелень и лук – исключительно при переносимости.
  • Из закусок разрешены спелые томаты и свежая морковь – не более 100 г до основного блюда, не более 2 раз/день
  • Нежирные сорта мяса/птицы. Основное правило — без жира, без сухожилий и кожи (у птицы). Форма приготовления: на пару или рубленое/протертое, отваренное, запеченное. Разрешена телятина и мясо кролика, допустимы фаршированные курой кабачки, тефтели и мясное пюре, котлеты на пару.
  • Рыба – исключительно на пару, в виде котлет или отварным куском. И только нежирные сорта
  • Яйца всмятку и белковый омлет
  • Молочные продукты разрешены только те, что отличаются низкой жирностью. Например, домашний 9-процентный творог, пудинги и сырники, вареники и творожная паста. Что касается сметаны и сливок, они допустимы только в качестве заправок в блюда. Молоко не запрещается, но его употребление возможно только при переносимости. Сыр также разрешен – нежирный и неострый
  • Вязкие каши (манка, греча, овсянка и рис). Можно добавить молока. Рекомендованы крупеники, пудинги и запеканки из круп
  • Макароны и лапша
  • Запеченные либо отварные овощи. Все овощи протирать или измельчать. Белокочанной капустой не злоупотреблять. Рекомендованы – картофель с зеленым горошком, свекла с морковкой цветная капуста, кабачки с тыквой
  • Из фруктов и ягод можно только спелые и сладкие, если в сыром виде — то протертыми, а также в отварном, в запеченном
  • Сладкое. Выбор не слишком большой, но потерпеть можно. Разрешены компоты из фруктов и желе, а также муссы (на сахаре, фруктозе либо ксилите)
  • Соусы допустимы, но только на овощных отварах, молоке либо фруктовых подливках. При этом муку пассеровать запрещено
  • Сливочное масло – не более 30 г/сутки. И растительное рафинированное – не более 15 г/блюдо
  • Напитки для диеты: слабый чай с долькой лимона, сахара – вдвое меньше обычного. Можно добавить молока. Также разрешены соки без использования сахара и с добавлением воды (не концентрированные, натуральные)

Запрещенные продукты

Продукты, которые запрещены для употребления:

  • Кислые фрукты. Инжир с виноградом
  • Из сладкого – мороженое с шоколадом и кондитерские изделия
  • Любые пряности и кулинарные жиры
  • Все холодные и/или газированные напитки, а также кофе с какао и виноградный сок
  • Сало и яйца в любом виде, кроме разрешенных
  • Жирные молочные продукты
  • Пшено и перловка, каша из кукурузы и ячневая
  • Слоеное и сдобное тесто, булочки и плюшки
  • Грибы и бобовые
  • Из овощей запрещены лук с чесноком и болгарский перец, щавель со шпинатом, редька с редисом
  • Любое жирное мясо и жирная рыба
  • Все консервы и копчености
  • Любые соленья/маринады, закуски
  • Свежий, ржаной хлеб
  • Крепкие бульоны и холодные супы (вроде окрошки). Супы из капусты, молочные и грибные

Варианты примерного диетического меню на неделю

Рацион стола №5п имеет некоторые отличия для болезни на стадии обострения и для стадии ремиссии.

Диета 5п при остром и хроническом панкреатите в стадии обострения

При болях в поджелудочной (при панкреатите в стадии обострения) меню предполагает блюда в протертом виде:

  • Завтрак №1 – греча (протереть) + котлеты (мясо) на пару + некрепкий чай с молоком.
  • Завтрак №2 – кисель + домашний творог.
  • Обед: овощной бульон с протертыми овощами + пюре (картофель) + суфле (мясо) + компот (яблоки протертые).
  • Полдник: сухарики с отваром шиповника.
  • Ужин: манка (можно добавить молока) + слабый чай + омлет (на пару, белковый).
  • Перед сном – минералка (полстакана Боржоми).

При стихании болей в поджелудочной можно использовать вариант меню с непротертой пищей:

  • Завтрак №1 — греча (в рассыпчатом виде) + винегрет (для заправки – не более 10 г растительного масла) + перемолотое мясо (отваренное) + полусладкий чай.
  • Завтрак №2 – некрепкий чай + несладкое печенье + чернослив.
  • На обед – суп (овощной бульон, порезанные овощи) + картофель (отварить) + кусочек отварной курицы + яблочко + чай.
  • Полдник – компот + домашний творог.
  • Ужин – некрепкий чай + вермишель + кусочек отварной рыбы.
  • Перед сном – сухарик + подслащенный чай с молоком.

Для 1-2-го дня обострения панкреатита рекомендовано употребление Боржоми и Славянской (до 1 л/день) – чуть подогретой, без газа и комнатной температуры. А также отвар шиповника.

При улучшении самочувствия (после 3-го дня) вводят в меню:

  • Слизистые супы и жидкие каши
  • Кисели и пюре из овощей

Диета 5п по Певзнеру при остром и хроническом панкреатите в стадии стихания

При стихании симптомов обострения панкреатита (с 3-4-го дня) показано следующее меню (приблизительный вариант):

  • Завтрак №1 – каша без масла (греча или рис), протертая + кисель молочный
  • Завтрак №2 – желе из фруктов + стакан Боржоми
  • Обед – суп на овсянке + пюре (морковь) + суфле (мясо) на пару + слабый чай
  • Полдник: отвар шиповника + омлет (на пару, белковый)
  • Ужин: некрепкий чай + протертая греча + суфле (творог)
  • Перед сном – минералка с сухариками

Все блюда – без использования соли, сахара на весь день – не более 20 г.

Рекомендации врачей-диетологов

— Диета номер 5п – исключительно лечебная. Недопустимо ее бесконтрольное применение для личных «похудательных» целей. К диете следует относиться со всей ответственностью (заболевание не шуточное).

Основные рекомендации – не увлекаться сахаром (строго по показаниям врача), исключить все сладости, кроме разрешенных. Сладости вызывают обострение и изжогу, метеоризм и прочие неприятности. То есть, для поджелудочной таких пациентов сладости – это яд. Особенно, если натощак.

Жиры также следует устранить – не более 60 г в сутки, причем распределять их следует аккуратно – в течение всего дня, а не все сразу.

— При лечебном столе номер 5п очень полезна минеральная вода. Пить ее можно вместо чая и компота, а также перед сном, небольшими порциями.

Всю пищу – шинковать или перемалывать. Грубые куски раздражают внутренние органы, при обострении (да и при стихании болезни) лишние раздражители совсем ни к чему. Зелень рекомендуется оставить до лучших времен, но при переносимости допускается добавление укропа, петрушки в блюдо.

И с блюдами из мяса — очень осторожно: во время обострения – строго на пару и воде, только в перетертом виде. При стихании симптомов можно приготовить бефстроганов (опять же, из отварного мяса), или даже в кусковом виде.

Тушеные и запеченные овощи – только при стихании болезни.

— Беспокоить поджелудочную железу при обострении заболевания – очень опасно. В этом состоянии положено максимально щадящее меню.

В первые дни вообще рекомендуется только Боржоми, причем без газов и в теплом виде. Или чуть сладкий и слабый чай.

Меню как таковое требуется уже после того, как обострение снято.

И даже при стихании болезни есть жесткие правила. Например, яйца вообще не рекомендуются (особенно желток), молоко также лучше исключить.

Читайте так же:

Стол номер 5: правила диеты для здоровья печени и желчного пузыря

https://ria. ru/20201224/dieta-1590764680.html

Стол номер 5: правила диеты для здоровья печени и желчного пузыря

Стол номер 5: правила диеты для здоровья печени и желчного пузыря — РИА Новости, 24.12.2020

Стол номер 5: правила диеты для здоровья печени и желчного пузыря

Стол номер 5 — рацион питания, разработанный еще в 1920-х годах. Когда его назначают и что он в себя включает — в материале РИА Новости. РИА Новости, 24.12.2020

2020-12-24T15:18

2020-12-24T15:18

2020-12-24T15:18

здоровый образ жизни (зож)

витамины

диета

питание

продукты

общество

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdn25.img.ria.ru/images/154897/64/1548976425_0:100:1920:1180_1920x0_80_0_0_a5f8c1e54ca598dd96f34a4eae777f5b.jpg

МОСКВА, 24 дек — РИА Новости. Стол номер 5 — рацион питания, разработанный еще в 1920-х годах. Когда его назначают и что он в себя включает — в материале РИА Новости. Показания к применениюОсобая диета под названием «Стол №5» назначается специалистами людям с заболеваниями печени, желчевыводящих путей и желчного пузыря: холецистите, гепатите, желчнокаменной болезни. Также ее можно применять для общего оздоровления организма.Питание «по столам» разработал основатель диетотерапии, советский врач Мануил Певзнер. Его диеты являются лечебными или создают благоприятные условия для восстановления организма человека. Также они помогают избежать обострения болезней. Система русского врача активно применяется при лечении заболеваний в стационарах, санаториях. Также столы рекомендуют пациентам и вне стен лечебных учреждений.Всего система включает в себя 15 групп рационов. Диеты столов №1, 1а, 1б назначают при язве желудка и двенадцатиперстной кишки; диету стола №2 — при атрофическом гастрите, колитах; диету стола №3 — при запорах; диеты столов №4, 4а, 4б, 4в — при болезнях кишечника с диареей; диеты столов №5, 5а — при заболеваниях желчных путей и печени; диету стола № 6 — при мочекаменной болезни, подагре; диеты столов №7, 7а, 7б, 7в, 7г — при хроническом и остром нефрите, хронической почечной недостаточности; диету стола №8 — при ожирении; диеты стола №9 — при сахарном диабете; диету стола №10 — при заболеваниях сердечно-сосудистой системы; диету стола №11 — при туберкулезе; диету стола №12 — при заболеваниях нервной системы; диету стола №13 — при острых инфекционных заболеваниях; диету стола №14 — при болезни почек с отхождением камней из фосфатов; диету стола №15 — при заболеваниях, не требующих особых диет. Часто эти рационы питания называют столами ОВД. Аббревиатура расшифровывается как «основной вариант диеты». Цель диеты «Стол номер 5″При полноценном рационе диета стола 5 способствует снижению нагрузки на печень и желчевыводящую систему. Щадящее питание диеты «Стол №5» способствует нормализации работы желчных путей и печени, улучшает желчеотделение и налаживает обмен холестерина в организме. Общая характеристика диетыРацион диетического стола 5 включает в себя нормальное содержание белков и углеводов в меню, но ограниченное количество жира. Готовить блюда разрешается двумя способами — их нужно варить и запекать, правда, изредка можно тушить. Подавать готовую еду нужно только в теплом виде.Мясо и рыбу важно мелко рубить, делать из них фарш или суфле. Разрешены для 5 стола рецепты протертых овощных, молочных и крупяных супов. При этом они должны быть без мяса, рыбы и грибов. Масла можно использовать только в качестве заправок к блюдам, а молочные продукты следует выбирать с пониженной жирностью. Яйца допускается есть в ограниченном количестве, лучше всмятку или в составе омлета.Хлеб при диете стола 5 нужно употреблять вчерашний. Также можно включать в питание сухари или галеты. Из круп врачи рекомендуют гречку, овес, манку, рис. Кроме того, разрешаются макароны из твердых сортов пшеницы.Овощи можно отваривать, запекать, есть сырыми. Разрешается включить в меню 5 стола горошек, морковь, тыкву, свеклу, помидоры, огурцы, картофель, кабачки, цветную капусту. Овощи, богатые клетчаткой, важно перетирать.Из фруктов можно есть бананы, груши и некислые яблоки, а вот зелень и специи, грибы, чеснок, редис нужно ограничить.Из десертов разрешены желе, запеканки, пудинги, мед и сухофрукты. В ограниченном количестве можно есть пастилу, мармелад и варенье. Из напитков — травяные чаи, некрепкий черный и зеленый чай, соки, компоты, кисели.Запрещено употреблять острое, копченое, жареное, субпродукты, консервы, сало. Полностью исключаются из рациона соусы, газировка, спиртное, какао и черный кофе. Также нельзя шоколад, мороженое, клюкву, цитрусовые.Режим питанияВо время соблюдения диеты 5 стола обязательно пить много воды натощак. Питаться важно дробно — употреблять небольшие равные порции 5 -6 раз в день, через каждые 2,5-3 часа.Суточный рацион (энергетическая ценность и химический состав)Продукты и блюда, включенные в питание в сутки, должны содержать до 80 грамм белков (50% из которых животного происхождения), до 80-90 грамм жиров (30% из которых растительного происхождения), а также до 400 грамм углеводов. Кроме того, необходимо выпивать до 1,5-2 литров воды.Общая энергетическая ценность суточного рациона при диете «Стол №5» — примерно 2400 — 2800 килокалорий. При этом разрешается употреблять не более 10 грамм соли.Примерное меню на каждый день медицинской диеты «5 стол»:Как долго нужно питаться по диете №5— Длительность данной диеты определяется исключительно врачом, — подчеркнула эксперт.Срок лечебной программы питания зависит от динамики течения имеющегося заболевания. Иногда продолжительность диеты может составлять до полутора лет.

https://rsport.ria.ru/20201218/pokhudenie-1589908647.html

https://ria.ru/20201216/voda-1589509891.html

https://ria.ru/20201216/sekret-1589474115.html

https://radiosputnik.ria.ru/20201221/menyu-1589943402.html

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2020

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdn23.img.ria.ru/images/154897/64/1548976425_107:0:1814:1280_1920x0_80_0_0_9b718a9d5a6f815abbc14d0dc06a0e58.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

здоровый образ жизни (зож), витамины, диета, питание, продукты, общество

МОСКВА, 24 дек — РИА Новости. Стол номер 5 — рацион питания, разработанный еще в 1920-х годах. Когда его назначают и что он в себя включает — в материале РИА Новости.

Показания к применению

Особая диета под названием «Стол №5» назначается специалистами людям с заболеваниями печени, желчевыводящих путей и желчного пузыря: холецистите, гепатите, желчнокаменной болезни. Также ее можно применять для общего оздоровления организма.

Питание «по столам» разработал основатель диетотерапии, советский врач Мануил Певзнер. Его диеты являются лечебными или создают благоприятные условия для восстановления организма человека. Также они помогают избежать обострения болезней.

Система русского врача активно применяется при лечении заболеваний в стационарах, санаториях. Также столы рекомендуют пациентам и вне стен лечебных учреждений.

— Эта система питания учитывает наиболее часто встречающиеся острые и хронические заболевания. Ведь именно питание и образ жизни часто являются основой выздоровления. Сейчас в современной диетологии потихоньку отходят от разделения на «столы», но, тем не менее, именно такая классификация облегчает работу с пациентами и повышает комплаентность — склонность пациентов соблюдать рекомендации врача, — рассказала РИА Новости диетолог-эндокринолог Раушания Хисматуллина.

18 декабря 2020, 15:30ЗОЖКак похудеть за две недели? Советы от фитнес-модели

Всего система включает в себя 15 групп рационов. Диеты столов №1, 1а, 1б назначают при язве желудка и двенадцатиперстной кишки; диету стола №2 — при атрофическом гастрите, колитах; диету стола №3 — при запорах; диеты столов №4, 4а, 4б, 4в — при болезнях кишечника с диареей; диеты столов №5, 5а — при заболеваниях желчных путей и печени; диету стола № 6 — при мочекаменной болезни, подагре; диеты столов №7, 7а, 7б, 7в, 7г — при хроническом и остром нефрите, хронической почечной недостаточности; диету стола №8 — при ожирении; диеты стола №9 — при сахарном диабете; диету стола №10 — при заболеваниях сердечно-сосудистой системы; диету стола №11 — при туберкулезе; диету стола №12 — при заболеваниях нервной системы; диету стола №13 — при острых инфекционных заболеваниях; диету стола №14 — при болезни почек с отхождением камней из фосфатов; диету стола №15 — при заболеваниях, не требующих особых диет.

Часто эти рационы питания называют столами ОВД. Аббревиатура расшифровывается как «основной вариант диеты».

Цель диеты «Стол номер 5»

При полноценном рационе диета стола 5 способствует снижению нагрузки на печень и желчевыводящую систему.

Щадящее питание диеты «Стол №5» способствует нормализации работы желчных путей и печени, улучшает желчеотделение и налаживает обмен холестерина в организме.

16 декабря 2020, 15:07НаукаУченые рассказали о лечебных свойствах обычной воды

Общая характеристика диеты

Рацион диетического стола 5 включает в себя нормальное содержание белков и углеводов в меню, но ограниченное количество жира. Готовить блюда разрешается двумя способами — их нужно варить и запекать, правда, изредка можно тушить. Подавать готовую еду нужно только в теплом виде.

Мясо и рыбу важно мелко рубить, делать из них фарш или суфле. Разрешены для 5 стола рецепты протертых овощных, молочных и крупяных супов. При этом они должны быть без мяса, рыбы и грибов. Масла можно использовать только в качестве заправок к блюдам, а молочные продукты следует выбирать с пониженной жирностью. Яйца допускается есть в ограниченном количестве, лучше всмятку или в составе омлета.

Хлеб при диете стола 5 нужно употреблять вчерашний. Также можно включать в питание сухари или галеты. Из круп врачи рекомендуют гречку, овес, манку, рис. Кроме того, разрешаются макароны из твердых сортов пшеницы.

Овощи можно отваривать, запекать, есть сырыми. Разрешается включить в меню 5 стола горошек, морковь, тыкву, свеклу, помидоры, огурцы, картофель, кабачки, цветную капусту. Овощи, богатые клетчаткой, важно перетирать.

Из фруктов можно есть бананы, груши и некислые яблоки, а вот зелень и специи, грибы, чеснок, редис нужно ограничить.

Из десертов разрешены желе, запеканки, пудинги, мед и сухофрукты. В ограниченном количестве можно есть пастилу, мармелад и варенье. Из напитков — травяные чаи, некрепкий черный и зеленый чай, соки, компоты, кисели.

Запрещено употреблять острое, копченое, жареное, субпродукты, консервы, сало. Полностью исключаются из рациона соусы, газировка, спиртное, какао и черный кофе. Также нельзя шоколад, мороженое, клюкву, цитрусовые.

16 декабря 2020, 12:45

Диетолог раскрыла секрет сохранения отличной формы во время праздников

Режим питания

Во время соблюдения диеты 5 стола обязательно пить много воды натощак. Питаться важно дробно — употреблять небольшие равные порции 5 -6 раз в день, через каждые 2,5-3 часа.

— Частое дробное питание небольшими порциями, в теплом виде, не перегружает желудочно-кишечный тракт и способствует мягкому желчеоттоку, — отметила Раушания Хисматуллина.

Суточный рацион (энергетическая ценность и химический состав)

Продукты и блюда, включенные в питание в сутки, должны содержать до 80 грамм белков (50% из которых животного происхождения), до 80-90 грамм жиров (30% из которых растительного происхождения), а также до 400 грамм углеводов. Кроме того, необходимо выпивать до 1,5-2 литров воды.

Общая энергетическая ценность суточного рациона при диете «Стол №5» — примерно 2400 — 2800 килокалорий. При этом разрешается употреблять не более 10 грамм соли.

Примерное меню на каждый день медицинской диеты «5 стол»:

  • Завтрак: творог низкопроцентной жирности со сметаной и сахаром, овсянка на воде или нежирном молоке, чашка некрепкого чая.

  • Второй завтрак: печеное яблоко

  • Обед: суп из овощей на растительном масле без мяса, отварная курица в молочном соусе, вареный рис, компот из свежих фруктов или сухофруктов

  • Полдник: отвар из шиповника, несдобная выпечка с творогом

  • Ужин: нежирная вареная рыба в сметанном соусе, пюре из картофеля, ватрушка с творогом, чашка некрепкого чая

  • За полчаса перед сном — стакан низкопроцентного по жирности кефира.

Как долго нужно питаться по диете №5

— Длительность данной диеты определяется исключительно врачом, — подчеркнула эксперт.

Срок лечебной программы питания зависит от динамики течения имеющегося заболевания. Иногда продолжительность диеты может составлять до полутора лет.

21 декабря 2020, 04:00Сказано в эфиреДиетолог рекомендовала «антиковидное» меню

Диета 5п меню на неделю при панкреатите

Панкреатит опасен не только сильной болью, но и осложнениями. Среди них не только отказ поджелудочной железы, но и проблемы в работе печени и сердца, а также риск на развитие сахарного диабета. Когда врач назначает дополнительно к таблеткам и физпроцедурам диету 5п, то лучше соблюдать это меню при панкреатите минимум несколько недель, чтобы органы ЖКТ успели восстановиться. Небольшие ограничения в приеме пищи резко снизят болевые ощущения и ускорят регенерацию поджелудочной железы.

Общие сведения о диете

15 столов – это общее название для диетической системы. Ее разработал основатель диетологии Мануил Исаакович Певзнер в далеком 1927 году.

[stextbox id=»warning»]Каждый стол разработан с учетом всех необходимых организму питательных веществ и носит исключительно медицинский характер. Эти диеты применяются только при согласовании с врачом и не используются для похудения.[/stextbox]

Но, справедливости ради, стоит учесть, что соблюдение правил питания помогает избавиться и от лишних килограммов в период лечения.

Продукты стоит употреблять строго по табличке

Меню на неделю в диете 5п используется при хроническом панкреатите. Подразумевается, что период обострения уже закончился и пациенту требуется реабилитация.

Поэтому используется щадящий пищеварительный тракт режим питания с минимумом жиров. Также важен не только химический состав блюд, но и текстура еды, а также ее температура.

Механическое и термическое воздействия также влияют на состояние желудка и кишечника.

Интересно! Хурма при панкреатите

Характеристика стола 5п

В первые дни обострения панкреатита человеку назначается голодовка.

Постепенно по мере стихания симптомов рацион расширяется, но очень медленно, чтобы не спровоцировать новых нарушений в работе поджелудочной железы.

Данные продукты стоит употреблять в еде после стихания симптомов

Все продукты при этом сильно измельчаются или вовсе перетираются до состояния пюре. Готовка происходит несколькими способами:

  1. На воде. Можно отварить блюда, приготовить на пару или протушить, чтобы создать определенное разнообразие в меню.
  2. На огне. Жареная и копченая пища под полным запретом. Зато продукты можно запекать, не добавляя жировой основы.
  3. Электромагнитное излучение. Мультиварка и микроволновка также подойдут для приготовления пищи. Электрический разогрев поможет проще запекать продукты порционно, не беспокоясь о том, как распределяется жар в духовке.
  4. Консервация. Различные виды маринованных, соленых и консервированных блюд находятся под запретом.

Даже при таких ограничениях рецепты в меню на неделю при панкреатите согласно диете 5п могут быть разнообразными. Главное следовать нескольким правилам:

  1. Питание дробное. Пища употребляется 5-6 раз в сутки небольшими порциями.
  2. Органический состав. Диета подразумевает увеличение количества потребляемых белков, витаминов и липотропных соединений, обезжиривающих печень. Углеводы и жиры при этом должны попадать в организм в меньших количествах. Также резко ограничивается содержание холестирина, пуринов, эфирных масел и тугоплавких жиров, а также экстрактивных веществ, способствующих усилению работы желез.
  3. Температурный режим. Вся еда должна подаваться теплой. Термический диапазон должен составлять 15-50 градусов по Цельсию. Лучше всего употреблять пищу, разогретую до температуры тела.
  4. Пищевая ценность. Питание предполагает поглощение около 2500 килокалорий в день. При этом должно соблюдаться соотношение:
Вещества Количество
Белки 100-120 г (из них животные составляют 2/3)
Жиры 60-80 г (из них растительные составляют 1/5)
Углеводы 300-360 г (сахар не более 40 г)
Соль 10 г
Вода питьевая (используется не для готовки) 1,5 л

[stextbox id=»warning»]Чтобы блюда полностью соответствовали всем требованиям надо серьезно отнестись к выбору продуктов, которые будут составлять рацион.[/stextbox]

На заметку! Что можно есть при обострении при панкреатите

Под запретом

Кроме жареной пищи, придется также отказаться и от целого ряда других продуктов питания.

Особенное недовольство меню на неделю при панкреатите может вызвать у детей, ведь диета 5п исключает мороженное, мед, варенье, шоколад а также ряд других любимых продуктов:

Тип Что запрещено
Молочные продукты Молоко высокой жирности, сливки, творог и соленые\острые сыры. Также не рекомендуется употребление молочных каш и супов. Полностью запрещено мороженое из-за температурного режима.
Мучные изделия Под запретом ржаные мучные изделия, а также пирожные, выпечка из дрожжевого и слоеного теста, кремовые сладости. Пшеничный хлеб можно употреблять только подсохший.
Зерновые Рассыпчатые каши под запретом. Особенно это относится к ячневой, перловой, кукурузной и пшенным крупам.
Кулинарные жиры Сало, смалец, растительное и сливочное масло при готовке не используются.
Овощи Грибы, бобовые (кроме сои) и другие продукты с грубой клетчаткой употреблять нельзя. В этот список включаются баклажаны, редис, белокочанная капуста, репа, брюква, редька. Также необходимо ограничивать потребление салата и щавеля, болгарского перца и лука.
Фрукты Продукты, богатые на простые углеводы, лучше исключить для профилактики повышенного газообразования. Среди них цитрусовые, финики, бананы и виноград.
Мясо Запрещены не только копченые продукты. Также нельзя вводить в рацион свинину и баранину, утку и гусиное мясо. Также придется отказаться от блюд из субпродуктов.
Рыба Жирные виды водоплавающих, особенно лосось, семга и форель. Также под запретом икра.
Специи О кетчупе и майонезе придется на время забыть. Также необходимо отказаться от укропа и петрушки, пряных трав и различных острых приправ: перца, хрена, горчицы, чеснока, имбиря, васаби и прочих.
Напитки Алкоголь, черный кофе и горячий шоколад или какао. Также придется прекратить употребление газированных напитков, цитрусовых, гранатовых и виноградных соков.

Важно учитывать, что овощи и фрукты лучше не давать свежими на первых порах следования диете. Лучше всего их запекать и перетирать.

Спустя несколько недель при положительной динамике врач подскажет, какие позиции можно вернуть в меню.

Можно и нужно

Оздоровительная диета должна не только защищать пищеварительный тракт от перегрузок. Организму для лечения требуется много питательных веществ.

Творог обязательно есть при панкреатите

Поэтому при составлении меню на неделю при панкреатите согласно диете 5п надо следовать следующей таблице разрешенных продуктов:

Тип Что разрешено
Молочные продукты Простокваша, творог и кефир до 1,5% жирности, неострый сыр. Молоко только при добавлении в блюда в малом количестве. Нежирная сметана, как приправа.
Мучные изделия Позавчерашний пшеничный хлеб, несдобное печенье со временем
Зерновые Гречневая, манная и овсяная крупы, а также клейкий рис
Кулинарные жиры Со временем вводится сливочное масло по 20 г в сутки и растительное (рафинированное подсолнечное) по 15 г для приготовления пищи.
Овощи Отварные свекла, картофель, тыква, цветная капуста, кабачки, морковь, зеленый горошек. Со временем можно добавить помидоры и огурцы.
Фрукты Основа – печеные перетертые яблоки. Также можно готовить чернослив, урюк и курагу.
Мясо Говядина, телятина, кролик и курица. Лучше всего в виде изделий на пару из фарша.
Рыба Треска, путассу, судак, щука, хек, окунь, сазан, минтай.
Специи Соль до 10г. Сахар и мед в малых количествах
Напитки Некрепкий чай с добавлением лимона и ксилита. Также рекомендуется отвар шиповника, компоты из свежих фруктов (Груши, яблоки и абрикосы), а также сладкие соки. Столовая негазированная вода.

Более точное распределение продуктов по категориям «Можно\Нельзя» подскажет врач исходя из состояния здоровья больного.

Меню на неделю

Несмотря на все ограничения, сделать рацион достаточно богатым несложно.

Пудинг на основе каши

Для этого достаточно в течение недели чередовать ряд различных блюд и проявить немного фантазии:

  1. Завтрак. Для первого блюда лучше всего подойдут перетертые каши и пудинги на их основе. Также можно дополнить прием пищи творогом с фруктовым пюре. Еще один вариант – запеченный белковый омлет. Запивать еду можно соком, чаем с молоком или лимоном.
  2. 2-й завтрак. Творог, мясное суфле, омлет или печеные фрукты станут отличным перекусом. Из напитков можно предложить соки моркови или тыквы, настой шиповника.
  3. Обед. На первое лучше всего дать один из вариантов овощных супов-пюре, варьируя ингредиенты. На второе можно использовать мясо в виде кнелей, паровых котлет, фрикаделек или запеченных рулетов. В качестве напитка лучше использовать кисель, компот или отвар шиповника.
  4. Полдник. Творожное суфле, немного печенье или обычный банан с чаем, персиковым соком или киселем на выбор.
  5. Ужин. Лучше всего использовать рис или овощное пюре с разнообразными рыбными блюдами. В качестве напитка лучше всего подойдет абрикосовый сок или чай с молоком.
  6. Перед сном. На ночь можно дать пациенту немного кисломолочных продуктов. Это может быть кефир или простокваша.

При таком рационе человек точно не будет голодать. При этом можно проявить все свои кулинарные таланты, сделав процесс выздоровления вкусным и приятным.

 Загрузка …

[autor_bq]

Диета — стол №5 — Центр трансплантации печени НИИ СП имени Н.В. Склифосовского

Общие положения

Показания

Хронический гепатит с признаками слабовыраженной функциональной
недостаточности печени, хронический холецистит, желчнокаменная болезнь,
острый гепатит в период выздоровления, хронический колит со склонностью к
запорам, хронический гастрит без резких нарушений, хронический
панкреатит в стадии ремиссии.

Назначение

Обеспечение потребности организма в пищевых веществах и энергии,
восстановление нарушенных функций печени и желчных путей, механическое и
химическое щажение желудка и кишечника, разгрузка жирового и
холестеринового обмена, стимуляция нормальной деятельности кишечника.

Характеристика

Нормальное содержание белков и углеводов при ограничении тугоплавких
жиров, азотистых экстрактивных веществ и холестерина. Блюда отвариваются
или готовятся на пару, а также запекаются в духовке. Протирают жилистое
мясо и богатые клетчаткой овощи. Температура готовых блюд 20-52⁰С.

Основной принцип

Частое и дробное питание. Рекомендованы каждые 3-4 часа малыми порциями.

Состав и энергоценность

  • — Белки – 100г,
  • — жиры 90г (из них 1/3 растительные),
  • — углеводы 300-350 (из них простых (сахара) – 50-60г),
  • — калорийность 2600-3000 ккал,
  • — ретинол 0,5мг,
  • — каротин 10,5мг,
  • — тиамин 2 мг,
  • — рибофлавин 4 мг,
  • — никотиновая кислота 20мг,
  • — аскорбиновая кислота 200 мг,
  • — натрий 4 г,
  • — калий 4,5 г,
  • — кальций 1,2 г,
  • — фосфор 1,6 г,
  • — магний 0,5 г,
  • — железо 0,015 г.
  • — Суточное потребление поваренной соли – 6-10 г,
  • — свободной жидкости – до 2 л.

Перечень продуктов

Продукты Рекомендуется Исключается
Хлеб и хлебобулочные изделия Хлеб пшеничный из муки I и II сорта, ржаной из
сеяной муки, вчерашней выпечки, выпечные несдобные изделия с вареными
мясом и рыбой, творогом, яблоками, сухой бисквит
Свежий хлеб. Слоеное и сдобное тесто, пирожные, торты, жареные пирожки, шоколад, кремовые изделия
Мясо и рыба Нежирные говядина, телятина, мясная свинина,
кролик, рыба нежирных сортов, курица без кожи, отварные или запеченные
после отваривания. Докторская, молочная и диабетическая колбасы,
неострая нежирная ветчина, сосиски молочные, вымоченная в молоке сельдь,
заливная рыба (после отваривания).
Жирные сорта мяса и рыбы, гусь, утка, печень,
почки, мозги, копчености, соленая рыба, икра, большинство колбас,
консервы, свиное, говяжье, баранье сало
Супы Супы овощные и крупяные на овощном отваре, молочные с макаронными изделиями, фруктовые, борщи и щи вегетарианские Мясные, рыбные и грибные бульоны, окрошки, соленые щи
Молочные продукты Невысокой жирности – молоко, кефир, йогурт,
простокваша. Полужирный творог в натуральном виде, в виде запеканок,
пудингов, ленивых вареников.
Сливки, молоко 6% жирности, жирная сметана
Яйца Омлет, яйца всмятку Яйца вкрутую, сырые, жареные
Овощи Различные овощи в отварном, запеченном, тушеном виде Бобовые, шпинат, щавель, редис, редька, чеснок, грибы, маринованные овощи
Напитки Чай, кофе с молоком, фруктовые, ягодные, овощные соки, компоты, кисели Алкогольные напитки, черный кофе, какао

Варианты меню на один день

Вариант №1.

Первый завтрак.
Творожный пудинг – 150 г.
Овсяная каша – 150 г.
Чай с молоком – 1 стакан.

Второй завтрак.
Морковь сырая, фрукты – 150 г.
Чай с лимоном – 1 стакан.

Обед.
Суп картофельный вегетарианский со сметаной – 1 тарелка. Мясо отварное запечённое– 125 г.
Кабачки, тушёные в сметане – 200 г.
Кисель из яблочного сока – 200 г.

Полдник.
Отвар шиповника – 1 стакан.
Сухое печенье.

Ужин.
Рыба отварная – 100 г.
Пюре картофельное – 200 г.
Чай с лимоном – 1 стакан.

На весь день:
Хлеб белый – 200 г,
хлеб ржаной – 200 г,
сахар – 50-70 г.

Вариант №2.

Первый завтрак.
Белковый омлет из 2 белков – 100 г.
Чай с молоком — 1 стакан.

Второй завтрак.
Яблоки печёные протертые – 100 г.

Обед.
Суп рисовый с протертыми овощами ½ порции.
Курица отварная – 115 г.
Каша гречневая, протертая – 150 г.
Молочное желе – 125 г.

Полдник.
Сухарики с сахаром.
Отвар шиповника – 1 стакан.

Ужин.
Рыба отварная – 85 г.
Картофельное пюре – 150 г.
Чай с молоком — 1 стакан.

Перед сном.
Кисель фруктовый – 1 стакан.

На весь день:
Хлеб белый – 200 г,
хлеб ржаной – 200 г,
сахар – 50-70 г.

Диета №5п

В свою очередь, диета 5п включает в себя два варианта:

  • 1-й – для пациентов с острым панкреатитом и обострением хронического;
  • 2-й – для пациентов с хроническим панкреатитом в период после купирования обострения и во время ремиссии.

Диета №5п – первый вариант

Показания: назначается при остром панкреатите и обострении хронического, начиная со 2-4 дня от начала атаки болезни – когда завершается период голодания или осуществляется переход с парентерального питания на энтеральное.

Цели диеты

Главная цель – обеспечить максимальный покой воспаленному органу. Это достигается следующим образом:

  • исключение продуктов и блюд, способных стимулировать секреторную активность поджелудочной железы, желудка и желчного пузыря;
  • исключение продуктов и блюд, обладающих раздражающим действием на слизистые оболочки пищеварительного тракта и поджелудочную;
  • исключение трудноперевариваемых продуктов и блюд;
  • исключение продуктов с прямым повреждающим действием на поджелудочную железу.

Режим питания

Питание дробное, прием пищи через каждые 2 часа (6-8 раз в сутки), маленькими порциями – по 200-300 г.

Кулинарная обработка блюд

Разрешаются только отварные или приготовленные на пару блюда, с последующим измельчением (пюрирование, перетирание, взбивание на блендере) до жидкого или полужидкого состояния. Все блюда подаются только в теплом виде.

Ассортимент разрешенных продуктов

  • Крупы: рисовая, манная, гречневая, овсяная – протертые полувязкие, сваренные на воде или на воде пополам с молоком. Крупы используются также для приготовления вегетарианских супов.
  • Хлебобулочные и макаронные изделия: хлеб пшеничный черствый или в виде сухарей, макароны отварные.
  • Мясо и птица: только постные сорта (курица, индейка, крольчатина, говядина, телятина). Выбирают мясо с нежными волокнами, тщательно очищают его от пленок и сухожилий. Мясные блюда подаются в виде изделий из фарша (дважды прокрученного) или суфле.
  • Рыба: тощие сорта (треска, судак, минтай, пикша, щука).
  • Молоко: используется только для приготовления блюд.
  • Кисломолочные продукты: нежирный творог, кефир, ряженка, йогурт, простокваша – только свежие и без искусственных добавок. Сметана низкой жирности – в блюдах.
  • Масло сливочное и растительное: в блюдах, небольшим количеством (до 5 г в сутки) – не ранее, чем через 10-14 дней от атаки панкреатита.
  • Овощи: кабачок, картофель, морковь, свекла, цветная капуста, брокколи, тыква.
  • Фрукты: пюре из запеченных или отварных яблок.
  • Яйца: только в виде белкового омлета на пару.
  • Напитки: негазированная минеральная вода, отвар шиповника, компоты и кисели на фруктово-ягодных соках, отвары сухофруктов, слабый чай.

Все блюда готовятся дома из разрешенных продуктов, непосредственно перед употреблением, без использования соли и сахара. В качестве подсластителей разрешается использовать сахарозаменители. Применять готовые продукты питания и полуфабрикаты не рекомендуется.

Пример меню на неделю первого варианта диеты 5п

Диета №5п – второй вариант

Показания: назначается в период ремиссии хронического панкреатита.

Цели диеты

  1. Обеспечить скорейшее восстановление поджелудочной железы и всех ее функций. Для этого диета обогащается белком, витаминами, минералами.
  2. Предотвратить обострение хронического панкреатита, для чего продолжают соблюдать основные принципы питания (исключать либо существенно ограничивать раздражающие, трудноперевариваемые продукты и продукты, обладающие прямым повреждающим действием на поджелудочную железу).
  3. Предотвратить формирование осложнений, в том числе сахарного диабета (ограничиваются легкоусвояемые углеводы, исключается алкоголь).

Режим питания

Питание дробное, дневной интервал между приемами пищи – не более 4 часов (5-тиразовое питание), объем пищи на один прием – в пределах 500-600 г (включая жидкость).

Кулинарная обработка блюд

Помимо отваренной и приготовленной на пару еды, в меню появляются тушеные и запеченные блюда. В период нестойкой ремиссии блюда желательно измельчать, при переходе заболевания в стадию стойкой ремиссии разрешается употреблять блюдо куском, тщательно пережевывая пищу. Фрукты и ягоды (неопасные) и соки из них можно включать в питание без термической обработки (свежими). Блюда по-прежнему подаются в теплом виде.

Ассортимент разрешенных продуктов

  • Крупы: рисовая, манная, гречневая, овсяная, пшеничная. Ячневая и перловая крупы – с осторожностью.
  • Бобовые: только мягкий молодой зеленый горошек (свежий или замороженный), спаржевая фасоль.
  • Хлебобулочные и макаронные изделия: хлеб пшеничный черствый или в виде сухарей, несдобная домашняя выпечка, несдобное печенье, макаронные изделия отварные и в запеканках.
  • Мясо и птица: нежирные курица, индейка, крольчатина, говядина, телятина, свинина, баранина. Мясо тщательно очищают его от жира, пленок и сухожилий.
  • Рыба: тощие сорта и сорта с низкой жирностью (треска, судак, минтай, пикша, щука, постная сельдь, лещ, горбуша, тунец и др.).
  • Молоко: используется только для приготовления блюд.
  • Кисломолочные продукты: нежирный творог, кефир, ряженка, йогурт, простокваша – только свежие и без искусственных добавок. Сметана и сливки низкой жирности – в блюдах. Сыр нежирный, предпочтительнее мягкий.
  • Масло сливочное и растительное: в блюдах, небольшим количеством (до 20 г сливочного и до 15 г растительного в сутки).
  • Овощи: кабачок, картофель, морковь, свекла, цветная капуста, брокколи, тыква. С осторожностью – белокочанная капуста, томаты, баклажаны.
  • Зелень: укроп, петрушка – мелкорубленные, после легкой термической обработки (обдать кипятком или высыпать в кипящее блюдо перед снятием с огня).
  • Фрукты и ягоды: некислые разновидности с низким содержанием грубых растительных волокон (сладкие яблоки, дыня, арбуз, абрикос, сливы, черешня и др.). Только полностью спелые, очищенные от грубой кожицы и семян.
  • Яйца: в виде омлета, всмятку, для приготовления отдельных блюд (запеканок, суфле).
  • Напитки: негазированная минеральная вода, отвар шиповника, компоты и кисели на фруктово-ягодных соках, отвары сухофруктов, слабый чай, цикорий, свежевыжатые фруктовые, ягодные и овощные соки (разбавленные).
  • Сладости: мед, варенье, джемы, зефир, пастила, мармелад, домашние муссы и ягодные желе, сладкое суфле. В ограниченном количестве. При сахарном диабете – исключаются.
  • Соль – от 5 до 10 г в сутки, сахар – до 30 г в сутки.

Пример меню на неделю второго варианта диеты 5п

Продукты и блюда, запрещенные при диете №5п

  1. Алкоголь.

  2. Грибы.

  3. Уксус.

  4. Острые приправы (перец, горчица, хрен и др.).

  5. Мясные и рыбные бульоны.

  6. Копчености.

  7. Мясные субпродукты.

  8. Маринады, соления.

  9. Бобовые.

  10. Продукты промышленного производства с содержанием искусственных пищевых добавок (красители, ароматизаторы, консерванты, стабилизаторы и т.д.).

  11. Чрезмерно жирные продукта и блюда: жирные сорта мяса, птицы, рыбы; сало; кулинарный жир; жирные сметана и сливки, жирные сорта сыра.

  12. Из сладостей – мороженое, сгущенное молоко, шоколад.

  13. Из напитков – кофе, какао, квас, газированные напитки.

  14. Из овощей: острые (лук репчатый, редис, редька, чеснок, дайкон), кислые (щавель, шпинат).

  15. Из фруктов и ягод: кислые (лимоны, грейпфруты).

  16. Выпечка из сдобного и слоеного теста, ржаной хлеб и хлеб с отрубями.

  17. Жареные блюда.

Кроме того, обязательно учитываются степень сохранности основных функций поджелудочной железы и индивидуальная переносимость отдельных продуктов и блюд. Любое новое блюдо вводится постепенно, а при малейшем дискомфорте его немедленно отменяют.

показания и виды, что можно и нельзя есть

Диета 5п — это модификация стола №5 по Певзнеру.

Что такое диета 5п

Эта система питания направлена на снижение продукции ферментов поджелудочной железы и улучшение метаболизма в органах ЖКТ.

Ее применяют при терапии:

  • острого и хронического панкреатита;
  • холецистита;
  • желчнокаменной болезни.

Стол №5п также полезен при жировом гепатозе печени.

Первые несколько дней пациенту предписывается голодание. В дальнейшем весь период соблюдения диеты делится на 2 части, на протяжении которых в рацион пациента постепенно включают продукты, чтобы не спровоцировать резкого повышения нагрузки и рецидива. Исключаются грубая клетчатка и экстрактивные вещества.

Первая часть накладывает жесткие ограничения, а вторая (более мягкая) предполагает введение в рацион дополнительных блюд.

Диета 5п направлена на снижение нагрузки на органы пищеварения. 

Особенности приготовления блюд стола 5п

Диетический стол № 5п требует употребления пищи, которая не будет раздражать или травмировать органы ЖКТ. Блюда нужно готовить путем варки, обработки паром и тушения. Недопустимо использование острых специй и большого количества соли. Мясо перед отвариванием следует порезать на мелкие куски. Такая обработка поможет устранить из него экстрактивные вещества.

При панкреатите пациентам можно употреблять вегетарианские супы-пюре. Каши должны быть слизистыми. На протяжении первой фазы после термической обработки продукты дополнительно протираются. В этот период фрукты могут применяться только для изготовления желе, киселей и т.д. Во второй фазе диеты нет необходимости перетирать блюда, но они должны иметь мягкую консистенцию. Рекомендованная температура блюд — +23…+35°C.

Разрешенные продукты

В таблице представлены главные продукты, которые можно вводить в рацион:

Вид Особенности продуктов
Хлеб и выпечка Подсушенный хлеб Крекеры Печенье галетное Вафли
Птица и мясо Индюшатина Филе перепелки Крольчатина Курятина Постная говядина
Рыба Путассу Лемонема Треска Сайда Щука Макрель Навага Хек Пангасиус Минтай Хариус
Молочная продукция Сгущенное молоко Творог Молоко (нежирное) Сметана
Супы Овощные супы
Крупы Гречневая Рисовая Кукурузные хлопья Манная
Яйца Белок Желток (ограниченно)
Фрукты и сухофрукты Яблоки Вишня Виноград Абрикос Груша Персик Нектарин Изюм Хурма Слива Бананы
Овощи (термически обработанные) Капуста цветная Брокколи Цукини Морковь Тыква Патиссоны Свекла Редис Огурцы Сладкий перец Помидоры Баклажаны Петрушка Листовой салат
Напитки Морковный сок Некрепкий чай Кисель Компот
Сладости Желе Пудинги Мед Творожные запеканки Зефир

Продукты, которые нежелательны

Некоторые продукты провоцируют повышение выработки ферментов поджелудочной железой, поэтому их требуется исключить.

Они перечислены в следующей таблице:

Вид Особенности продуктов
Хлеб и выпечка Свежий белый и ржаной хлеб Сдоба
Птица и мясо Утятина Гусятина Жирная и жилистая говядина Куриные сердечки Баранина Печень Копчености Почки Свинина Колбасные изделия
Рыба и морепродукты Икра Молоки Сом Скумбрия Палтус Сельдь Килька Сайра Осетр Горбуша
Молочная продукция Жирные творог и сметана Простокваша Майонез Сыр пармезан Острые и соленые сорта сыра
Супы Зеленый борщ Жирные бульоны Рассольник
Крупы Нешлифованная рисовая Пшенная Перловая
Яйца Вареные и жареные яйца
Фрукты Все свежие фрукты
Овощи Консервированные и свежие овощи Нут Редька Брюква Салатный перец
Напитки Газированная вода Кофе Спиртные напитки
Десерты Мороженое Крем Выпечка Шоколад

Мягкая диета

Мягкая диета, т.е. вторая часть стола №5, назначается пациентам, у которых была подавлена острая симптоматика панкреатита. Кроме того, такой рацион полезен людям, страдающим хронической формой патологии и стремящимся не допустить обострения. Вторая часть диетического стола назначается на 5-7-й день после обострения.

Эта часть системы питания предполагает употребление в сутки:

  • жиров — 80 г;
  • белков — 80 г;
  • углеводов — 300 г.

Калорийность пищи повышается до 2500 ккал. В сутки можно употреблять до 8 г соли. На этой фазе пациенту разрешается ввести в рацион неперетертые овощи и фрукты, подвергшиеся термической обработке. Медленно в рацион вводят мягкие, а затем твердые продукты. По мере расширения меню увеличивают объем порций. Количество приемов пищи сокращают до 5-6 раз.

Диета 5п включает необходимое здоровому организму количество овощей.

Жесткая диета

Жесткая диета, или первая часть стола №5п, назначается в период обострения панкреатита.

Она рассчитана на 5-7 дней и предполагает:

  • включение белков до 60 г;
  • понижение нормы жиров до 50 г;
  • употребление до 200 г углеводов;
  • до 8 приемов пищи в день маленькими порциями;
  • исключение соли;
  • употребление протертых слизистых блюд на воде.

Соблюдать правила диеты следует на любом этапе развития воспалительного процесса.

На протяжении всего периода пациентам требуется низкокалорийный рацион.

Примерное меню на неделю

Важно заблаговременно составить меню на неделю. Оно может выглядеть так:

Понедельник

  1. Завтрак: каша из гречки, суфле из творога.
  2. Ланч: кисель из молока, галетное печенье.
  3. Обед: суп-пюре из овощей, отварная рыба, разваренный рис, компот.
  4. Полдник: салат из отварной свеклы и моркови.
  5. Ужин: тефтели из куриного фарша, овощная икра.

Вторник

  1. Завтрак: паровой белковый омлет, овощное рагу.
  2. Ланч: домашнее желе, манная каша, кипяченый сок моркови.
  3. Обед: суп-пюре, суфле из индейки, макароны.
  4. Полдник: 2 отварных яичных белка, несколько ломтиков нежирного сыра.
  5. Ужин: каша из тыквы, запеченная рыба, чай.

Паровой белковый омлет — достаточно питательное блюдо.

Среда

  1. Завтрак: протертая рисовая каша, паровая котлета из курятины.
  2. Ланч: творог.
  3. Обед: картофельное пюре, котлеты из рыбного фарша.
  4. Полдник: манный пудинг, компот.
  5. Ужин: овощное рагу, говяжий рулет, чай.

Четверг

  1. Завтрак: овсяная каша, джем, галетное печенье, разбавленный сок.
  2. Ланч: кальцинированный творог, компот.
  3. Обед: гречневый суп с протертой курицей, паровые тефтели, запеченные овощи.
  4. Полдник: рисовый пудинг, компот.
  5. Ужин: отварной хек, овощное рагу, кисель.

Овсяная каша — наиболее полезный вариант завтрака.

Пятница

  1. Завтрак: рисовая каша, рыбные котлеты, молочный кисель.
  2. Ланч: галетное печенье, компот из сухофруктов.
  3. Обед: вегетарианский борщ, рисовая каша, котлеты.
  4. Полдник: творожная запеканка с курагой.
  5. Ужин: вермишель, филе индейки, кисель.

Суббота

  1. Завтрак: молочный суп, белковый омлет, чай.
  2. Ланч: компот, галетное печенье.
  3. Обед: овощной суп, гречневая каша, куриные кнели, чай.
  4. Полдник: желе из творога, чай с медом.
  5. Ужин: отварной картофель, куриные котлеты, компот.

Молочный суп — это блюдо, в котором в качестве жидкой основы используется молоко. 

Воскресенье

  1. Завтрак: паровая рыбная котлета, винегрет, чай.
  2. Ланч: запеканка из творога.
  3. Обед: суфле из крольчатины, макароны, компот из сухофруктов.
  4. Полдник: запеченное яблоко.
  5. Ужин: рыбные кнели с овощной подливой, несколько ломтиков хлеба, чай с молоком.

Рецепты блюд

При диете № 5п допускается употребление многих продуктов. Из них можно приготовить немало вкусных и полезных блюд.

Суп-пюре из кабачков и моркови

Суп-пюре из моркови и кабачков не содержит жестких растительных волокон и оказывает обволакивающее действие.

Потребуются:

  • кабачок — 0,5 кг;
  • морковь — 200 г;
  • картофель — 2 шт.;
  • куркума — 0,5 ч. л.;
  • молотый кориандр — 0,5 ч. л.;
  • молоко — 100 мл.

Суп-пюре из кабачков и моркови варится на овощном бульоне. 

Можно добавить в суп небольшое количество соли.

Этапы приготовления супа-пюре:

  1. Промыть и очистить все овощи.
  2. Отварить морковь и картофель.
  3. Добавить в кастрюлю измельченный кабачок.
  4. Смесь варить еще 10-15 минут.
  5. Слить большую часть овощного отвара.
  6. Протереть блендером горячие овощи.
  7. Развести пюре молоком или бульоном до нужной консистенции.

Овощной суп

Овощные супы являются важной частью диеты №5п.

Для приготовления блюда потребуются:

  • картофель — 3 шт.;
  • кабачок — 0,5 кг;
  • морковь — 1 шт.;
  • сладкий перец — 1 шт.;
  • репчатый лук — 1 шт.;
  • петрушка — небольшой пучок;
  • растительное масло — 1 ст. л.

Овощной суп — основа правильного питания.

По вкусу можно вводить в состав супа прованские травы и неострые специи.

Приготовление блюда включает в себя следующие этапы:

  1. Картошку, морковь, лук, кабачок тщательно вымыть, очистить от кожуры и нарезать.
  2. Сладкий перец очистить от сердцевины и разрезать на 4-6 кусков.
  3. Лук и морковь слегка обжарить на растительном масле.
  4. К зажарке добавить сладкий перец и тушить смесь 2-3 минуты.
  5. В воде отварить картофель.
  6. Через 15 минут в кастрюлю добавить измельченный кабачок.
  7. К готовым овощам присоединить зажарку.

Примерно за 5 минут до готовности следует добавить в суп измельченную зелень и специи.

Рисовый суп-пюре

Рисовый суп-пюре можно приготовить из разрешенных столом №5п продуктов.

Потребуются:

  • белый рис — 50 г;
  • луковица — 1 шт.;
  • морковь — 1 шт.;
  • оливковое масло — 2 ст. л.;
  • вода — 2 л.

Рисовый суп-пюре можно готовить на мясном, грибном или овощном бульоне.

Процесс приготовления блюда включает следующие этапы:

  1. Промытый рис залить водой и отварить.
  2. Лук и морковь помыть, очистить и нарезать кубиками.
  3. На оливковом масле обжарить морковь и лук.
  4. За 7 минут до готовности риса добавить к нему зажарку.

Готовый суп необходимо тщательно перетереть блендером.

Молочный суп с мясным пюре

Разнообразить меню поможет молочный суп с мясным пюре. Рецепт его приготовления несложен.

Требуемые ингредиенты:

  • нежирная телятина — 200 г;
  • молоко — 1 стакан;
  • вода — 300 мл;
  • морковь — 1 шт.;
  • луковица — 1 шт.;
  • сливочное масло — 1 ст. л.;
  • мука — 1 ст. л.

Молочный суп с мясным пюре — сытное и питательное блюдо.

Приготовление блюда включает следующие этапы:

  1. Телятину отварить.
  2. Муку обжарить на сливочном масле.
  3. Лук и морковь вымыть, очистить и измельчить.
  4. Овощи слегка обжарить на растительном масле.
  5. Отварную телятину измельчить в блендере.
  6. В сковороде соединить муку, овощи и мясо, а затем обжарить 3-5 минут.
  7. В смесь добавить горячее молоко.
  8. Состав взбить блендером до однородной массы.

Готовое блюдо можно присыпать зеленью.

Пудинг из морковки

Пудинг из моркови — это вкусный и низкокалорийный десерт, который можно быстро приготовить в домашних условиях.

Потребуются:

  • морковь — 200 г;
  • молоко — ¼ стакана;
  • яичный белок — 1 шт.;
  • манная крупа — 2 ч. л.;
  • сахар — 5 г;
  • сливочное масло — 1 ст. л.;
  • сметана — 2 ст. л.;
  • панировочные сухари — 15 г.

Пудинг из морковки — блюдо, относящееся не только к разряду полезных, но и вкусных.

Готовить пудинг лучше всего в духовке, но можно запекать его и в мультиварке.

Этапы процесса:

  1. Морковь помыть и очистить, а затем крупно натереть.
  2. Измельченный овощ тушить на молоке 15 минут на маленьком огне.
  3. Белок взбить до состояния плотной пены.
  4. Смешать морковную массу, сахар, манную крупу и яичную пену.
  5. Массу пудинга выложить на дно емкости.
  6. Форму поставить в духовку на 15 минут при температуре 180 °C.

К столу морковный пудинг следует подавать со сметаной. Сверху его можно присыпать маком или корицей.

Рулет из говядины с омлетом

Рулет из говядины с омлетом лучше готовить в пароварке, но при желании его можно сделать и на водяной бане.

Потребуются такие ингредиенты:

  • говяжий фарш — 200 г;
  • яйца — 4 шт.;
  • молоко — ½ стакана.

Нужно заранее приготовить рукав для запекания или плотную фольгу.

Рулет из говядины — необыкновенно вкусное блюдо.

Процесс приготовления включает такие этапы:

  1. Взбить молоко и 3 яйца.
  2. Фарш, смешанный с яйцом, выложить на фольгу так, чтобы его слой был около 2 см, затем тщательно уплотнить.
  3. На мясо выложить готовый омлет.
  4. С помощью фольги скрутить рулет.
  5. Края тщательно соединить.
  6. Рулет, завернутый в фольгу, в нескольких местах проколоть зубочисткой и поместить в духовку или пароварку для приготовления.

Готовый рулет нужно освободить от упаковки, нарезать кольцами и подать к столу. Дополнить блюдо можно сметанным соусом.

Треска в мультиварке

Филе трески можно приготовить в мультиварке без использования соли.

Потребуются:

  • филе трески — 0,5 кг;
  • петрушка и укроп — 3 ст. л.;
  • молотая гвоздика — ¼ ч. л.;
  • кориандр — ¼ ч. л.;
  • лимонный сок — 3 ст. л.;
  • растительное масло — 3 ст. л.

Треска в мультиварке — идеальный вариант обеда.

Приготовление этого блюда занимает 40 минут и состоит из следующих этапов:

  1. В отдельной емкости смешать лимонный сок, специи, зелень и растительное масло.
  2. Филе трески вымыть и слегка надрезать.
  3. Рыбу выложить на фольгу и обильно смазать смесью лимонного сока, растительного масла, зелени и специй.
  4. Края фольги завернуть, а треску поместить в мультиварку на 25-30 минут.

Подавать к столу запеченное филе можно с овощами, рисом или другим гарниром.

Куриные кнели с творогом

Куриные кнели с творогом хорошо утоляют голод, но при этом не создают нагрузку на органы ЖКТ.

Потребуются:

  • куриный фарш — 0,5 кг;
  • яйцо куриное — 1 шт.;
  • творог — 250 г;
  • свежий укроп — 2-3 веточки;
  • молотый перец — щепотка.

Куриные кнели с творогом — это блюдо, из домашней птицы.

При желании можно ввести в состав блюда немного соли.

Процесс приготовления кнелей включает в себя такие этапы:

  1. Творог протереть через сито.
  2. В отдельной емкости смешать фарш, творог, измельченный укроп и перец.
  3. Мокрыми руками сформировать небольшие котлеты и выложить их на решетку мультиварки или пароварки.
  4. Готовить кнели 25 минут.

Подавать к столу куриные кнели лучше со сметаной. К ним подойдет любой гарнир.

Творожное желе

Творожное желе является хорошей заменой многим десертам.

Для него потребуются:

  • творог — 400 г;
  • молоко — 100 мл;
  • сметана — 400 г;
  • желатин — 25 г;
  • сахар — 2-3 ст. л.

Творожное желе — десерт для любителей сладостей.

При необходимости от использования сахара можно отказаться.

Процесс приготовления блюда следующий:

  1. В молоке растворить желатин и оставить набухать 30 минут.
  2. Емкость с молоком поставить на огонь и прогреть.
  3. Творог протереть через сито, смешать с сахаром и сметаной.
  4. В творожную массу ввести растворенный в молоке желатин.
  5. Смесь тщательно вымешать и разлить по формам.

Желе помещают на 2 часа в холодильник. Чтобы облегчить его извлечение из емкости, форму необходимо опустить на минуту в теплую воду.

Рисовый пудинг

Рисовый пудинг — еще один десерт, который можно быстро сделать дома.

Требуемые ингредиенты:

  • круглый рис — 60 г;
  • молоко — 1 стакан;
  • яйца — 2 шт.;
  • масло сливочное — 25 г;
  • изюм — 20 г;
  • сахар — 1 ст. л.

Рисовый пудинг — блюдо из риса, смешанного с водой или молоком.

Приготовление этого десерта занимает не более 30 минут.

Процесс включает в себя следующие этапы:

  1. Изюм промыть и залить водой для размягчения.
  2. На растопленном в кастрюле сливочном масле слегка обжарить рис.
  3. К рису добавить молоко и варить смесь еще 5-7 минут, чтобы зерна разбухли.
  4. Желтки отделить от белка и смешать с сахаром.
  5. Рис снять с огня и добавить к нему желтки.
  6. С изюма слить воду и добавить в рисовую основу.
  7. Белки взбить до получения плотной пены.
  8. Белковую пену небольшими порциями ввести в рисовую основу.
  9. Формы для запекания тщательно смазать сливочным маслом. В них выложить смесь.
  10. Запекать пудинг в течение 20 минут при температуре 170 °C.

Пудинг не вынимают из форм до остывания, подают к столу в холодном виде.

Манный пудинг с яблоками

Для приготовления в домашних условиях манного пудинга потребуются следующие ингредиенты:

  • манная крупа — 5 ст. л.;
  • молоко — 1 стакан;
  • яблоко — 2 шт.;
  • куриное яйцо — 2 шт.;
  • масло сливочное- 2 ст. л.;
  • сахар — 2 ст. л.

Манный пудинг с яблоками является своеобразным усовершенствованием манной каши.

Чтобы сделать манный пудинг, нужно:

  1. Налить молоко в кастрюлю и довести до кипения, а затем добавить к нему манную крупу и сахар.
  2. В готовую кашу влить 1 ст. л. масла.
  3. Белок взбить и смешать с охлажденной массой с манной крупой.
  4. Яблоки помыть, очистить, нашинковать и смешать с сахаром, а затем слегка обжарить.
  5. Форму смазать сливочным маслом. На дно налить приготовленную смесь, выложить яблоки, которые затем прикрыть слоем каши.
  6. Запекать пудинг 15 минут в духовке при температуре 170 °C.

Пудинг следует достать из формочек только после остывания. Блюдо можно подавать к столу вместе с фруктовым желе.

Отзывы и результаты

Эта система питания давно назначается пациентам при патологиях поджелудочной железы, поэтому есть немало отзывов о ней.

Светлана, 39 лет, Краснодар: «В прошлом году впервые столкнулась с приступом панкреатита. После 2 дней голодания врач назначил соблюдение диеты №5п. Были сложности с переходом на такой рацион. Пришлось учиться готовить полезные блюда, но после начала соблюдения диеты состояние улучшилось. Больше приступов не было».

Игорь, 47 лет, Иркутск: «В молодости злоупотреблял алкоголем, что привело к развитию хронического панкреатита. Попал в больницу, где врач назначил препараты и стол №5п. Начал соблюдать рекомендации специалиста и перешел на рекомендованное меню. Состояние быстро стабилизировалось».

Рекомендации врачей-диетологов

Жесткий вариант стола №5п следует использовать только по назначению врача. Хотя рекомендованные в этот период блюда и способствуют восстановлению работы поджелудочной железы, они содержат недостаточное количество витаминов и минералов. Мягкого варианта диеты можно придерживаться пожизненно, т.к. он более сбалансирован.

При соблюдении стола №5п нужно сократить до минимума употребление соли и сахара. Желательно отказаться от добавления этих веществ в блюда. Пищу необходимо употреблять небольшими порциями.

Посмотрите также варианты заказа индивидуального питания (если позволяет бюджет):

[miniposter=shortstory-mobile]

Низкобелковые диеты оказывают различное влияние на энергетический баланс

  • 1

    Gosby, A.K. et al. Тестирование использования протеина у худых людей: рандомизированное контролируемое экспериментальное исследование. пл. Один 6 , e25929 (2011).

    CAS
    ОБЪЯВЛЕНИЯ
    Статья

    Google Scholar

  • 2

    Симпсон, С. Дж. И Раубенхаймер, Д. Ожирение: гипотеза использования белка. Obes. Ред. 6 , 133–142 (2005).

    CAS
    Статья

    Google Scholar

  • 3

    Госби, А. К., Кониграв, А. Д., Раубенхаймер, Д. и Симпсон, С. Дж. Использование белка и потребление энергии. Obes. Ред. 15 , 183–191 (2014).

    CAS
    Статья

    Google Scholar

  • 4

    Leidy, H.J. et al. Роль белка в похудании и поддержании веса. г. J. Clin. Нутр (2015).

  • 5

    Пезешки А., Фахим А. и Челикани П. К. Диетическая сыворотка и казеин по-разному влияют на энергетический баланс, гормоны кишечника, метаболизм глюкозы и вкусовые предпочтения у крыс с ожирением, вызванных диетой. J. Nutr 145 , 2236–2244 (2015).

    CAS
    Статья

    Google Scholar

  • 6

    Solon-Biet, S.M. et al. Соотношение макроэлементов, а не потребление калорий, определяет кардиометаболическое здоровье, старение и продолжительность жизни мышей, получавших ad libitum. Cell Metab 19 , 418–430 (2014).

    CAS
    Статья

    Google Scholar

  • 7

    Уайт, Б. Д., Хе, Б., Дин, Р. Г. и Мартин, Р. Дж. Низкобелковые диеты повышают экспрессию гена нейропептида Y в базомедиальном гипоталамусе крыс. J. Nutr 124 , 1152–1160 (1994).

    CAS
    Статья

    Google Scholar

  • 8

    Белая, Б.Д., Портер, М. Х. и Мартин, Р. Дж. Влияние возраста на реакцию кормления на умеренно низкий диетический белок у крыс. Physiol Behav 68 , 673–681 (2000).

    CAS
    Статья

    Google Scholar

  • 9

    Двойной кинжал Уитед, Б. Д., Портер, М. Х. и Мартин, Р. Дж. Выбор белка, потребление пищи и состав тела в зависимости от количества пищевого белка. Physiol Behav 69 , 383–389 (2000).

    Артикул

    Google Scholar

  • 10

    Griffioen-Roose, S. et al. Белковый статус вызывает компенсаторные изменения в приеме пищи и пищевых предпочтениях. г. J. Clin. Нутр 95 , 32–38 (2012).

    CAS
    Статья

    Google Scholar

  • 11

    Griffioen-Roose, S. et al. Статус человеческого белка модулирует ответную реакцию мозга на пищевые сигналы. г.J. Clin. Нутр 100 , 113–122 (2014).

    Артикул

    Google Scholar

  • 12

    Мартенс, Э. А., Тан, С. Ю., Данлоп, М. В., Маттес, Р. Д., Вестертерп-Плантенга, М. С. Белок усиливает влияние говяжьего протеина на потребление энергии людьми. г. J. Clin. Нутр 99 , 1397–1406 (2014).

    CAS
    Статья

    Google Scholar

  • 13

    Мартенс, Э.А., Тан, С. Ю., Маттес, Р. Д. и Вестертерп-Плантенга, М. С. Отсутствие компенсации потребления белка из-за недостаточного потребления незаменимых аминокислот при низкобелковой диете в течение 12 дней. Nutr. Метаб (Лондон) 11 , 38 (2014).

    Артикул

    Google Scholar

  • 14

    Ду, Ф., Хиггинботам, Д. А. и Уайт, Б. Д. Потребление пищи, энергетический баланс и концентрация лептина в сыворотке крови у крыс, получавших диету с низким содержанием белка. J. Nutr 130 , 514–521 (2000).

    CAS
    Статья

    Google Scholar

  • 15

    Пенг, Ю.С., Мелиза, Л.Л., Вавич, М.Г. и Кеммерер, А.Р. Изменения в потреблении пищи и азотном обмене у крыс при адаптации к диете с низким или высоким содержанием белка. J. Nutr 104 , 1008–1017 (1974).

    CAS
    Статья

    Google Scholar

  • 16

    Kalhan, S.C. et al. Метаболический и геномный ответ на ограничение изокалорийного белка с пищей у крыс. J. Biol. Chem 286 , 5266–5277 (2011).

    CAS
    Статья

    Google Scholar

  • 17

    Laeger, T. et al. FGF21 — это эндокринный сигнал ограничения белка. J. Clin. Инвестируйте 124 , 3913–3922 (2014).

    CAS
    Статья

    Google Scholar

  • 18

    Энтони Т. Г. и Гитцен Д. В. Обнаружение аминокислотной депривации в центральной нервной системе. Curr. Opin. Clin. Nutr. Metab Care 16 , 96–101 (2013).

    CAS

    Google Scholar

  • 19

    Ротвелл, Н. Дж. И Сток, М. Дж. Влияние потребления углеводов и жиров на индуцированный диетой термогенез и активность бурого жира у крыс, получавших диеты с низким содержанием белка. J. Nutr 117 , 1721–1726 (1987).

    CAS
    Статья

    Google Scholar

  • 20

    Ротвелл, Н.Дж., Сток, М. Дж. И Тизбир, Р. С. Энергетический баланс и функция митохондрий в печени и бурый жир крыс, получавших «кафетерий» рацион с различным содержанием белка. J. Nutr 112 , 1663–1672 (1982).

    CAS
    Статья

    Google Scholar

  • 21

    Ротвелл, Н. Дж., Сток, М. Дж. И Тайзбир, Р. С. Механизмы термогенеза, вызванные диетами с низким содержанием белка. Метаболизм 32 , 257–261 (1983).

    CAS
    Статья

    Google Scholar

  • 22

    parecida de, F. S. et al. Низкобелковая диета изменяет энергетический баланс и симпатическую активность коричневой жировой ткани растущих крыс. Nutrition 25 , 1186–1192 (2009).

    Артикул

    Google Scholar

  • 23

    Глик, З., Тиг, Р. Дж. И Брей, Г. А. Коричневая жировая ткань: термический ответ усиливается при однократном приеме пищи с низким содержанием белка и высоким содержанием углеводов. Наука 213 , 1125–1127 (1981).

    CAS
    ОБЪЯВЛЕНИЯ
    Статья

    Google Scholar

  • 24

    Reidelberger, R., Haver, A. & Chelikani, P.K. Роль пептида YY (3-36) в насыщении, вызываемом доставкой макроэлементов в желудок у крыс. г. J. Physiol Endocrinol. Метаб 304 , E944 – E950 (2013).

    CAS
    Статья

    Google Scholar

  • 25

    Гершон, М.Д. и Тэк, Дж. Система передачи сигналов серотонина: от базового понимания до разработки лекарств для функциональных расстройств желудочно-кишечного тракта. Гастроэнтерология 132 , 397–414 (2007).

    CAS
    Статья

    Google Scholar

  • 26

    Crane, J. D. et al. Подавление периферического синтеза серотонина снижает ожирение и метаболическую дисфункцию, способствуя термогенезу коричневой жировой ткани. Nat. Мед 21 , 166–172 (2015).

    CAS
    Статья

    Google Scholar

  • 27

    О, К. М. и др. Регуляция системного энергетического гомеостаза серотонином в жировой ткани. Nat. Коммуна 6 , 6794 (2015).

    CAS
    Статья

    Google Scholar

  • 28

    McGlashon, J. M. et al. Центральные серотонинергические нейроны активируют и задействуют термогенный коричневый и бежевый жир и регулируют гомеостаз глюкозы и липидов. Cell Metab 21 , 692–705 (2015).

    CAS
    Статья

    Google Scholar

  • 29

    Savastano, D. M., Carelle, M. & Covasa, M. Рецепторы серотонина типа 3 опосредуют подавление потребления в кишечнике, вызванное поликозой и глюкозой. г. J. Physiol Regul. Интегр. Comp Physiol 288 , R1499 – R1508 (2005).

    CAS
    Статья

    Google Scholar

  • 30

    Савастано, Д.M. & Covasa, M. Питательные вещества кишечника вызывают насыщение за счет одновременной активации рецепторов CCK (1) и 5-HT (3). Physiol Behav 92 , 434–442 (2007).

    CAS
    Статья

    Google Scholar

  • 31

    Савастано, Д. М., Хейс, М. Р. и Коваса, М. Рецепторы серотонина типа 3 опосредуют индуцированное липидами кишечное насыщение и Fos-подобную иммунореактивность в заднем отделе заднего мозга. г. J. Physiol Regul.Интегр. Comp Physiol 292 , R1063 – R1070 (2007).

    CAS
    Статья

    Google Scholar

  • 32

    Huang, X. et al. Влияние диетического белка на углеводный баланс на потребление энергии, накопление жира и выработку тепла у мышей. Ожирение. (Серебро. Весна) 21 , 85–92 (2013).

    CAS
    ОБЪЯВЛЕНИЯ
    Статья

    Google Scholar

  • 33

    Солон-Бьет, С.M. et al. Соотношение белков и углеводов в рационе и ограничение калорий: сравнение результатов метаболизма у мышей. Cell Rep 11 , 1529–1534 (2015).

    CAS
    Статья

    Google Scholar

  • 34

    Алиппи, Р. М. и др. Динамика восстановления морфометрических переменных и свойств кортикальной кости на основе pQCT после кратковременного ограничения белка у созревающих крыс. Рост Dev. Старение 65 , 67–72 (2002).

    CAS

    Google Scholar

  • 35

    Boualga, A., Bouchenak, M. & Belleville, J. Низкобелковая диета предотвращает повышение активности липопротеинлипазы тканей у растущих крыс. руб. J. Nutr 84 , 663–671 (2000).

    CAS
    Статья

    Google Scholar

  • 36

    Lamri, MY, Meghelli-Bouchenak, M., Boualga, A., Belleville, J. & Prost, J. Состав и концентрация ЛПОНП в плазме крыс, а также активность липазы печени и липопротеинлипазы нарушаются при двух типах белка. недоедание и сбалансированное возобновление питания. J. Nutr 125 , 2425–2434 (1995).

    CAS
    Статья

    Google Scholar

  • 37

    Бек, Б., Доллет, Дж. М. и Макс, Дж. П. Возобновление кормления после различных периодов приема низкобелковой диеты: влияние на потребление пищи и массу тела у крыс. Physiol Behav 45 , 761–765 (1989).

    CAS
    Статья

    Google Scholar

  • 38

    Дуллоо, А.G. & Girardier, L. Влияние состава рациона на расход энергии во время восстановления массы тела у крысы: последствия для догоняющего роста и рецидива ожирения. Метаболизм 41 , 1336–1342 (1992).

    CAS
    Статья

    Google Scholar

  • 39

    Bengtsson, T., Cannon, B. & Nedergaard, J. Дифференциальная адренергическая регуляция экспрессии генов бета-адренорецепторов подтипов бета1, бета2 и бета3 в коричневых адипоцитах. Biochem. J 347 Pt 3, 643–651 (2000).

    CAS
    Статья

    Google Scholar

  • 40

    Zhao, J., Cannon, B. & Nedergaard, J. Термогенез бета3-, но не бета1-адренергически опосредуется в коричневых жировых клетках крыс даже после акклиматизации к холоду. г. J. Physiol 275 , R2002 – R2011 (1998).

    CAS

    Google Scholar

  • 41

    Бенгтссон, Т., Редегрен, К., Стросберг, А. Д., Недергаард, Дж. И Кэннон, Б. Подавление экспрессии гена бета3-адренорецептора в коричневых жировых клетках является временным, а восстановление зависит от короткоживущего белкового фактора. J. Biol. Chem 271 , 33366–33375 (1996).

    CAS
    Статья

    Google Scholar

  • 42

    Senault, C., Le, C., V. и Portet, R. Характеристики бета-адренергических рецепторов в изолированных клетках и в сырых мембранах коричневой жировой ткани. Biochimie 66 , 573–578 (1984).

    CAS
    Статья

    Google Scholar

  • 43

    Hondares, E. et al. Термогенная активация вызывает экспрессию и высвобождение FGF21 в коричневой жировой ткани. J Biol Chem 286 , 12983–12990, DOI: 10.1074 / jbc.M110.215889 (2011).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 44

    Дурис, Н.и другие. Центральный фактор роста фибробластов 21 окрашивает белый жир в коричневый цвет за счет симпатического действия у самцов мышей. Эндокринология 156 , 2470–2481, DOI: 10.1210 / en.2014-2001 (2015).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 45

    Lees, E. K. et al. Ограничение метионина восстанавливает более молодой метаболический фенотип у взрослых мышей с изменениями фактора роста фибробластов 21. Aging Cell 13 , 817–827 (2014).

    CAS
    Статья

    Google Scholar

  • 46

    Wanders, D. et al. Метаболические реакции на ограничение диетического лейцина включают ремоделирование жировой ткани и усиление передачи сигналов инсулина в печени. Биофакторы 41 , 391–402 (2015).

    CAS
    Статья

    Google Scholar

  • 47

    Фишер, Ф. М. и др. FGF21 регулирует PGC-1альфа и потемнение белых жировых тканей в адаптивном термогенезе. Genes Dev 26 , 271–281 (2012).

    CAS
    Статья

    Google Scholar

  • 48

    Ротвелл, Н. Дж. И Сток, М. Дж. Влияние диеты и фенфлурамина на термогенез у крыс: возможное участие серотонинергических механизмов. Внутр. J. Obes 11 , 319–324 (1987).

    CAS

    Google Scholar

  • 49

    Симпсон, К. Х., Мерфи П., Колтап П. В. и Уилан П. Концентрация ондансетрона в спинномозговой жидкости после перорального введения добровольцам. Психофармакология (Берл) 109 , 497–498 (1992).

    CAS
    Статья

    Google Scholar

  • 50

    Miles-Chan, J. L., Dulloo, A. G. & Schutz, Y. Окисление субстрата натощак в состоянии покоя оценивается с помощью непрямой калориметрии: является ли предварительный диетический уровень и состав макронутриентов второстепенным? Внутр.J. Obes. (Лондон) 39 , 1114–1117 (2015).

    CAS
    Статья

    Google Scholar

  • 51

    van Schothorst, EM, Bunschoten, A., Schrauwen, P., Mensink, RP & Keijer, J. Влияние диеты с высоким гликемическим индексом и низким гликемическим индексом с высоким содержанием жиров: замедление инсулинорезистентности связано с ожирением тканевая модуляция. FASEB J 23 , 1092–1101, DOI: 10.1096 / fj.08-117119 (2009).

    CAS
    Статья

    Google Scholar

  • 52

    Павляк, Д.Б., Брайсон, Дж. М., Дениер, Г. С. и Бранд-Миллер, Дж. С. Крахмал с высоким гликемическим индексом способствует гиперсекреции инсулина и увеличению жировых отложений у крыс, не влияя на чувствительность к инсулину. J Nutr 131 , 99–104 (2001).

    CAS
    Статья

    Google Scholar

  • 53

    Азиз, А. А., Кенни, Л. С., Гуле, Б. и Абдель-Аал, С. Тип диетического крахмала влияет на массу тела и гликемический контроль у крыс с ожирением, получающих пищу свободно, но без ограничения энергии. J Nutr 139 , 1881–1889, DOI: 10.3945 / jn.109.110650 (2009).

    CAS
    Статья

    Google Scholar

  • 54

    Ble-Castillo, J. L. et al. Дифференциальные эффекты состава диеты с высоким содержанием углеводов и жиров на метаболический контроль и инсулинорезистентность у нормальных крыс. Int J Environ Res Public Health 9 , 1663–1676, DOI: 10.3390 / ijerph

    63 (2012).

    CAS
    Статья
    PubMed
    PubMed Central

    Google Scholar

  • 55

    Тонни, М.Л., Арнольд, А. М., Росс, Д. А., Шааф, С. Л. и Рунсавиль, Т. Р. Энергетическая эффективность крыс, получавших рацион с низким или высоким содержанием белка и выращиваемых с контролируемой скоростью от 80 до 205 граммов. J Nutr 121 , 1397–1406 (1991).

    CAS
    Статья

    Google Scholar

  • 56

    Hillgartner, F. B. & Romsos, D. R. 5’-дейодирование йодтиронина у крыс, получавших диеты с низким содержанием белка: отсутствие корреляции с энергетическим балансом. J Nutr 117 , 368–375 (1987).

    CAS
    Статья

    Google Scholar

  • 57

    Химмс-Хаген, Дж. И Цуй, Дж. Ожирение: факторы питания и контроль . (изд. Romsos, D. R., Himms-Hagen J. & Suzuki M.). 81–95 (Базель, Каргер, 1991).

  • 58

    Tschop, M. & Heiman, M. L. Обзор моделей на грызунах для исследования ожирения. Curr. Protoc. Neurosci Unit 9.1 , 1–14 (2001).

    Google Scholar

  • 59

    Левин, Б.Э., Данн-Мейнелл, А. А., Балкан, Б. и Кизи, Р. Э. Селективное разведение индуцированных диетой ожирения и резистентности у крыс Sprague-Dawley. г. J. Physiol 273 , R725 – R730 (1997).

    CAS

    Google Scholar

  • 60

    Мерсер, Дж. Г. и Арчер, З. А. Возвращение диеты к вызванному диетой ожирению: индуцированная диетой экспрессия гипоталамического гена. евро. J. Pharmacol 585 , 31–37 (2008).

    CAS
    Статья

    Google Scholar

  • 61

    Национальный исследовательский совет (США). Подкомитет по питанию лабораторных животных. Потребности лабораторных животных в питательных веществах . 4-я ред. edn, (Национальная академия наук, 1995).

  • 62

    Nausheen, S., Shah, IH, Pezeshki, A., Sigalet, DL & Chelikani, PK Влияние рукавной гастрэктомии и транспозиции подвздошной кишки, отдельно или в комбинации, на потребление пищи, массу тела, гормоны кишечника и метаболизм глюкозы у крыс. г. J. Physiol Endocrinol. Метаб 305 , E507 – E518 (2013).

    CAS
    Статья

    Google Scholar

  • 63

    Ротвелл, Н. Дж., Сэвилл, М. Э. и Сток, М. Дж. Влияние питания «кафетерий» на энергетический баланс и индуцированный диетой термогенез у четырех линий крыс. J. Nutr 112 , 1515–1524 (1982).

    CAS
    Статья

    Google Scholar

  • 64

    Пезешки, А.И Челикани, П. К. Влияние желудочного обходного анастомоза по Ру и операций по транспозиции подвздошной кишки на метаболизм глюкозы и липидов в скелетных мышцах и печени. Surg Obes Relat Dis 10 , 217–228 (2014).

    Артикул

    Google Scholar

  • IJMS | Бесплатный полнотекстовый | Влияние хронических западных диет на безалкогольную жирную печень самцов мышей, изменяющих путь PPAR-γ с помощью правила

    miR-27b-5p

    Рисунок 1.
    Диеты с высоким содержанием жиров и высоким содержанием жиров и фруктозы увеличивают массу тела самцов и самок мышей. Масса тела самцов мышей C57BL / 6J ( A ) и самок ( D ) мышей, получавших LFD (диета с низким содержанием жиров) (светло-серые круги), HFD (диета с высоким содержанием жиров) (темно-серые квадраты) или HFD -HF (диета с высоким содержанием жиров и фруктозы) (черные треугольники) в течение 19 недель измерялась еженедельно. ( B, E ) Масса тела мышей LFD (серая полоса), HFD (темно-серая полоса) и HFD-HF (черная полоса) на диете в течение 20 недель. n = 10 мышей / группа, ANOVA с двусторонними повторными измерениями для A&D, t-тест и однофакторный ANOVA для B&E, # p <0.05 LFD по сравнению с HFD, p <0,01 LFD по сравнению с HFD, p <0,001 LFD по сравнению с HFD, ¥ p <0,05 LFD по сравнению с HFD-HF, ¢ p <0,01 LFD vs. HFD-HF, ¤ p <0,001 LFD по сравнению с HFD-HF, p <0,05 HFD по сравнению с HFD-HF. Репрезентативные изображения общего фенотипа мышей самцов ( C ) и самок ( F ) мышей, получавших LFD (левая панель — задняя и передняя), HFD (средние панели — задняя и передняя) или HFD-HF (правые панели — зад и перед) на 20 недель.( G ) Увеличение массы тела в период от 0 до 20 недель у самцов и самок мышей. n = 9–10, t-критерий и однофакторный дисперсионный анализ, p <0,001 LFD по сравнению с HFD, ¤ p <0,001 LFD по сравнению с HFD-HF, # p <0,05 LFD по сравнению с HFD, *** p <0,001 Женщины по сравнению с мужчинами. Показано значение p t-критерия. (H) Вес тела самцов и самок мышей в одной и той же диетической группе. n = 9–10 мышей / группу, был проведен t-тест, a p <0,0001.

    Рисунок 1.
    Диеты с высоким содержанием жиров и высоким содержанием жиров и фруктозы увеличивают массу тела самцов и самок мышей.Масса тела самцов мышей C57BL / 6J ( A ) и самок ( D ) мышей, получавших LFD (диета с низким содержанием жиров) (светло-серые круги), HFD (диета с высоким содержанием жиров) (темно-серые квадраты) или HFD -HF (диета с высоким содержанием жиров и фруктозы) (черные треугольники) в течение 19 недель измерялась еженедельно. ( B, E ) Масса тела мышей LFD (серая полоса), HFD (темно-серая полоса) и HFD-HF (черная полоса) на диете в течение 20 недель. n = 10 мышей / группа, ANOVA с двусторонними повторными измерениями для A&D, t-тест и однофакторный ANOVA для B&E, # p <0.05 LFD по сравнению с HFD, p <0,01 LFD по сравнению с HFD, p <0,001 LFD по сравнению с HFD, ¥ p <0,05 LFD по сравнению с HFD-HF, ¢ p <0,01 LFD vs. HFD-HF, ¤ p <0,001 LFD по сравнению с HFD-HF, p <0,05 HFD по сравнению с HFD-HF. Репрезентативные изображения общего фенотипа мышей самцов ( C ) и самок ( F ) мышей, получавших LFD (левая панель — задняя и передняя), HFD (средние панели — задняя и передняя) или HFD-HF (правые панели — зад и перед) на 20 недель.( G ) Увеличение массы тела в период от 0 до 20 недель у самцов и самок мышей. n = 9–10, t-критерий и однофакторный дисперсионный анализ, p <0,001 LFD по сравнению с HFD, ¤ p <0,001 LFD по сравнению с HFD-HF, # p <0,05 LFD по сравнению с HFD, *** p <0,001 Женщины по сравнению с мужчинами. Показано значение p t-критерия. (H) Вес тела самцов и самок мышей в одной и той же диетической группе. n = 9–10 мышей / группу, был проведен t-тест, a p <0,0001.

    Рисунок 2.
    Диета с высоким содержанием жиров и фруктозы усугубляет диабетический фенотип у самцов мышей ( A ), но не у самок мышей ( B ).Уровень глюкозы в крови натощак измеряли у мышей LFD (светло-серые столбцы), HFD (темно-серые столбцы) и HFD-HF (черные столбцы) на 2, 6, 10, 14 и 18 неделях диеты. n = 8 мышей / группа, повторные измерения, двухфакторный дисперсионный анализ, # p <0,05 LFD по сравнению с HFD, ¥ p <0,05 LFD по сравнению с HFD-HF, ¢ p <0,01 LFD по сравнению с HFD-HF .

    Рисунок 2.
    Диета с высоким содержанием жиров и фруктозы усугубляет диабетический фенотип у самцов мышей ( A ), но не у самок мышей ( B ).Уровень глюкозы в крови натощак измеряли у мышей LFD (светло-серые столбцы), HFD (темно-серые столбцы) и HFD-HF (черные столбцы) на 2, 6, 10, 14 и 18 неделях диеты. n = 8 мышей / группа, повторные измерения, двухфакторный дисперсионный анализ, # p <0,05 LFD по сравнению с HFD, ¥ p <0,05 LFD по сравнению с HFD-HF, ¢ p <0,01 LFD по сравнению с HFD-HF .

    Рисунок 3.
    Диеты с высоким содержанием жиров и фруктозы изменяют фенотип печени у самцов мышей, но не у самок. Вес печени и соотношение веса печени и веса тела самцов ( A ) или самок ( B ) мышей, получавших LFD (серая полоса), HFD (темно-серая полоса) и HFD-HF (черная полоса) с репрезентативными изображениями печень ex vivo от мышей, получавших LFD (верхняя панель), HFD (средняя панель) и HFD-HF (нижняя панель) в течение 20 недель.n = 9–10 мышей / группа, однофакторный дисперсионный анализ с апостериорным тестом Тьюки и t-тестом, * p <0,05, ** p <0,01, *** p <0,001. ( C ) Вес печени самцов и самок мышей в одной группе питания. n = 9–10 мышей / группу, было показано значение p t-критерия, a p <0,0001, b p = 0,0010.

    Рисунок 3.
    Диеты с высоким содержанием жиров и фруктозы изменяют фенотип печени у самцов мышей, но не у самок. Вес печени и соотношение веса печени и веса тела самцов ( A ) или самок ( B ) мышей, получавших LFD (серая полоса), HFD (темно-серая полоса) и HFD-HF (черная полоса) с репрезентативными изображениями печень ex vivo от мышей, получавших LFD (верхняя панель), HFD (средняя панель) и HFD-HF (нижняя панель) в течение 20 недель.n = 9–10 мышей / группа, однофакторный дисперсионный анализ с апостериорным тестом Тьюки и t-тестом, * p <0,05, ** p <0,01, *** p <0,001. ( C ) Вес печени самцов и самок мышей в одной группе питания. n = 9–10 мышей / группу, было показано значение p t-критерия, a p <0,0001, b p = 0,0010.

    Рисунок 4.
    Фруктоза приводит к ранним нарушениям непереносимости глюкозы у мышей-самцов, получавших HFD-HF ( i ), но не у самок мышей ( ii ). GTT проводили через ( A ) 8 недель, ( B ) 11 недель, ( C ) 13 недель, ( D ) 16 недель и ( E ) 20 недель на LFD (светло-серый, круг), HFD (темно-серый, квадрат) или HFD-HF (черный, треугольник) кормили самцов и самок мышей.( F J ) Область под анализом кривых соответствующих панелей ( A , E ) (светло-серые полосы-LFD, темно-серые полосы-HFD, черные полосы-HFD-HF). ITT проводились как ( K ) 2 недели, ( L ) 6 недель, ( M ) 10 недель, ( N ) 14 недель, ( O ) 17 недель и ( P ). 20 недель на самцах и самках мышей, получавших LFD (светло-серый, круг), HFD (темно-серый, квадрат) или HFD-HF (черный, треугольник). ( Q , V ) Соответствующая область под анализом кривой ITT, выполненным на панелях K P (светло-серые столбцы-LFD, темно-серые столбцы-HFD, черные столбцы-HFD-HF).n = 7-8 мышей / группу, однофакторный дисперсионный анализ с апостериорным тестом Тьюки, * p <0,05, ** p <0,01 и *** p <0,001 по сравнению с LFD.

    Рисунок 4.
    Фруктоза приводит к ранним нарушениям непереносимости глюкозы у мышей-самцов, получавших HFD-HF ( i ), но не у самок мышей ( ii ). GTT проводили через ( A ) 8 недель, ( B ) 11 недель, ( C ) 13 недель, ( D ) 16 недель и ( E ) 20 недель на LFD (светло-серый, круг), HFD (темно-серый, квадрат) или HFD-HF (черный, треугольник) кормили самцов и самок мышей.( F J ) Область под анализом кривых соответствующих панелей ( A , E ) (светло-серые полосы-LFD, темно-серые полосы-HFD, черные полосы-HFD-HF). ITT проводились как ( K ) 2 недели, ( L ) 6 недель, ( M ) 10 недель, ( N ) 14 недель, ( O ) 17 недель и ( P ). 20 недель на самцах и самках мышей, получавших LFD (светло-серый, круг), HFD (темно-серый, квадрат) или HFD-HF (черный, треугольник). ( Q , V ) Соответствующая область под анализом кривой ITT, выполненным на панелях K P (светло-серые столбцы-LFD, темно-серые столбцы-HFD, черные столбцы-HFD-HF).n = 7-8 мышей / группу, однофакторный дисперсионный анализ с апостериорным тестом Тьюки, * p <0,05, ** p <0,01 и *** p <0,001 по сравнению с LFD.

    Рисунок 5.
    Подавление PPARγ в печени мышей-самцов, получавших HFD и HFD-HF, но не самок мышей. Печень мышей LFD, HFD и HFD-HF, соблюдающих диету в течение 20 недель, анализировали на предмет регуляторных маркеров печени. Экспрессию генов ( A ) PPARγ, ( B ) SCD1 и ( C ) FAS в мужской печени анализировали, при этом экспрессия была нормализована к β-актину.( D ) Экспрессию белков PPARγ, SCD1 и FAS анализировали в печени самцов мышей LFD, HFD и HFD-HF с помощью вестерн-блоттинга. ß-Актин использовали в качестве контроля загрузки. Денситометрический анализ проводили на самцах мышей ( D ) в виде столбиковой диаграммы под блотом PPARγ (слева), SCD1 (в центре) и FAS (справа). ( E ) Денситометрия экспрессии белков PPARγ и PPARγ в печени самок мышей. n = 8 мышей / группа, однофакторный дисперсионный анализ с апостериорным тестом Тьюки, * p <0,05, ** p <0,01, *** p <0.001 по сравнению с LFD.

    Рисунок 5.
    Подавление PPARγ в печени мышей-самцов, получавших HFD и HFD-HF, но не самок мышей. Печень мышей LFD, HFD и HFD-HF, соблюдающих диету в течение 20 недель, анализировали на предмет регуляторных маркеров печени. Экспрессию генов ( A ) PPARγ, ( B ) SCD1 и ( C ) FAS в мужской печени анализировали, при этом экспрессия была нормализована к β-актину. ( D ) Экспрессию белков PPARγ, SCD1 и FAS анализировали в печени самцов мышей LFD, HFD и HFD-HF с помощью вестерн-блоттинга.ß-Актин использовали в качестве контроля загрузки. Денситометрический анализ проводили на самцах мышей ( D ) в виде столбиковой диаграммы под блотом PPARγ (слева), SCD1 (в центре) и FAS (справа). ( E ) Денситометрия экспрессии белков PPARγ и PPARγ в печени самок мышей. n = 8 мышей / группа, однофакторный дисперсионный анализ с апостериорным тестом Тьюки, * p <0,05, ** p <0,01, *** p <0,001 по сравнению с LFD.

    Рисунок 6.
    Изменения экспрессии микроРНК в мужской печени . Экспрессию miRNA анализировали в печени мышей-самцов на LFD, HFD или HFD-HF в течение 20 недель.Изменения экспрессии ( A , B ) miR-27a-3p / -5p и ( C , D ) miR-27b-3p / -5p в мужской печени между LFD, HFD и HFD- ВЧ группы. n = 7 мышей / группа, однофакторный дисперсионный анализ с апостериорным тестом Тьюки, * p <0,05, ** p <0,01 по сравнению с LFD.

    Рисунок 6.
    Изменения экспрессии микроРНК в мужской печени . Экспрессию miRNA анализировали в печени мышей-самцов на LFD, HFD или HFD-HF в течение 20 недель. Изменения экспрессии ( A , B ) miR-27a-3p / -5p и ( C , D ) miR-27b-3p / -5p в мужской печени между LFD, HFD и HFD- ВЧ группы.n = 7 мышей / группа, однофакторный дисперсионный анализ с апостериорным тестом Тьюки, * p <0,05, ** p <0,01 по сравнению с LFD.

    Рисунок 7.
    Экспрессия мРНК регуляторов фиброза в мужской печени. Изменения экспрессии ( A ) TGFβ и ( B ) Col1a1 в печени среди групп LFD, HFD и HFD-HF в течение 20 недель. n = 7 мышей / группа, t-тест.

    Рисунок 7.
    Экспрессия мРНК регуляторов фиброза в мужской печени. Изменения экспрессии ( A ) TGFβ и ( B ) Col1a1 в печени среди групп LFD, HFD и HFD-HF в течение 20 недель.n = 7 мышей / группа, t-тест.

    Рисунок 8.
    Накопление липидов при западных диетах. Типичные микрофотографии в светлом поле с 10-кратным и 40-кратным увеличением окрашенных H&E срезов печени самцов мышей на LFD, HFD или HFD-HF в течение 20 недель. ( A , D ) Изображение соответствует печени мышей LFD с нормальной дольчатой ​​структурой, без признаков аномалии и меньшим размером клеток. ( B , E ) Изображение соответствует печени мышей HFD с большими отложениями липидов и гораздо более крупными клетками.( C , F ) Изображение соответствует печени мышей HFD-HF с менее частыми крупными отложениями липидов по сравнению с изображением HFD, но с увеличением количества присутствующих клеток меньшего размера.

    Рисунок 8.
    Накопление липидов при западных диетах. Типичные микрофотографии в светлом поле с 10-кратным и 40-кратным увеличением окрашенных H&E срезов печени самцов мышей на LFD, HFD или HFD-HF в течение 20 недель. ( A , D ) Изображение соответствует печени мышей LFD с нормальной дольчатой ​​структурой, без признаков аномалии и меньшим размером клеток.( B , E ) Изображение соответствует печени мышей HFD с большими отложениями липидов и гораздо более крупными клетками. ( C , F ) Изображение соответствует печени мышей HFD-HF с менее частыми крупными отложениями липидов по сравнению с изображением HFD, но с увеличением количества присутствующих клеток меньшего размера.

    Рисунок 9.
    Предлагаемая модель западной диеты индуцировала промежуточную стадию между ожирением печени и фиброзом посредством эпигенетической регуляции.Показано, что эпигенетические и генетические молекулярные пути регулируются диетой с высоким содержанием жиров и фруктозы. Диета вызывает промежуточное состояние прогрессирования заболевания печени, когда молекулярная сигнализация указывает на прогрессирование фиброза при НАЖБ, но еще не проявляет фенотип. Предлагаемые потенциальные биомаркеры микроРНК показаны во время прогрессирования вместе с изменениями транскрипции. * Возможно новый биомаркер прогрессирования p <0,05 (HFD), p <0,01 (HFD-HF).

    Рисунок 9.
    Предлагаемая модель западной диеты индуцировала промежуточную стадию между ожирением печени и фиброзом посредством эпигенетической регуляции.Показано, что эпигенетические и генетические молекулярные пути регулируются диетой с высоким содержанием жиров и фруктозы. Диета вызывает промежуточное состояние прогрессирования заболевания печени, когда молекулярная сигнализация указывает на прогрессирование фиброза при НАЖБ, но еще не проявляет фенотип. Предлагаемые потенциальные биомаркеры микроРНК показаны во время прогрессирования вместе с изменениями транскрипции. * Возможно новый биомаркер прогрессирования p <0,05 (HFD), p <0,01 (HFD-HF).

    Рисунок 10.
    Анализ пути изобретательности.Представляющие интерес маркеры (PPARγ, miR-27, SCD1, FAS) были введены в программу IPA компанией Invitrogen для поиска соответствующих связей между регуляторными путями. Несвязанные нижестоящие маркеры удаляются; показаны только прямые соединения.

    Рисунок 10.
    Анализ пути изобретательности. Представляющие интерес маркеры (PPARγ, miR-27, SCD1, FAS) были введены в программу IPA компанией Invitrogen для поиска соответствующих связей между регуляторными путями. Несвязанные нижестоящие маркеры удаляются; показаны только прямые соединения.

    miRNA-10a-5p снижает резистентность к инсулину и поддерживает суточные закономерности триглицеридов и кишечной микробиоты у мышей с высоким содержанием жиров.

    miRNA-10a ритмично экспрессируется и регулирует гены, участвующие в метаболизме липидов и глюкозы. Однако эффекты miRNA-10a на ожирение и непереносимость глюкозы, а также на суточный характер экспрессии генов циркадных часов остаются неизвестными. Мы исследовали влияние miRNA-10a-5p на инсулинорезистентность и на суточные характеристики сывороточных триглицеридов и микробиоты кишечника у мышей, получавших диету с высоким содержанием жиров (HFD-).Результаты показали, что пероральное введение miRNA-10a-5p значительно предотвращало увеличение массы тела и улучшало толерантность к глюкозе и чувствительность к инсулину у мышей, получавших HFD. Введение miRNA-10a-5p также поддерживало суточный ритм экспрессии Clock , Per2 и Cry1 , а также уровни глюкозы и триглицеридов в сыворотке. Удивительно, но суточные колебания трех родов микробов, Oscillospira , Ruminococcus и Lachnospiraceae , нарушенные кормлением HFD, поддерживаются введением miRNA-10a-5p.Более того, была обнаружена сильная положительная корреляция между экспрессией Clock в печени и относительной численностью Lachnospiraceae как у контрольных мышей (), так и у мышей, которым вводили miRNA-10a-5p (). Кроме того, мы обнаружили, что наряду с изменениями численности Lachnospiraceae содержание бутирата в кале сохраняло суточный ритм после введения miRNA-10a-5p мышам, получавшим HFD. В заключение мы предполагаем, что miRNA-10a-5p может улучшать HFD-индуцированную непереносимость глюкозы и инсулинорезистентность за счет модуляции суточного ритма Lachnospiraceae и его метаболита бутирата.Следовательно, miRNA-10a-5p может иметь профилактические свойства у субъектов с метаболическими нарушениями.

    1. Введение

    Растущие темпы ожирения и сахарного диабета 2 типа являются всемирной проблемой здравоохранения, от которой страдают миллионы людей. Переедание и снижение физических нагрузок являются основными причинами этих тревожных явлений. Среди множества факторов, участвующих в развитии ожирения, гипергликемии и инсулинорезистентности, важную роль играет кишечная микробиота.Длительное потребление диеты с высоким содержанием жиров (HFD) может привести к дисбиозу микробиоты кишечника, а субъекты с ожирением часто характеризуются низким микробным разнообразием и нарушением состава микробиоты [1–3].

    Циркадная ритмичность играет решающую роль в поддержании физиологического гомеостаза и общего состояния здоровья. Нарушение циркадного ритма часто связано с возникновением и развитием ожирения, диабета 2 типа и других метаболических синдромов [4]. Предыдущие исследования с использованием моделей циркадных нарушений на грызунах показали, что кормление HFD неблагоприятно модулирует циркадные сигналы, предполагая двунаправленное регулирование между циркадными сигналами и диетой [5].Однако связанные механизмы нуждаются в дальнейшем выяснении. Недавно было обнаружено, что микробиом кишечника, жизненно важный медиатор для увлечения диетического состава, участвует в поддержании циркадного ритма [6]. Важно отметить, что микробиом кишечника демонстрирует суточный ритм и вызывает колебания в своих метаболитах, и эти суточные колебания могут быть нарушены приемом HFD [6, 7].

    МикроРНК (miRNAs), класс эндогенно малых некодирующих РНК, состоящих из 19-25 нуклеотидов, могут оказывать ингибирующее или стимулирующее действие на экспрессию генов-мишеней посттранскрипционно.Недавно было показано, что эти важные генно-регуляторные единицы модулируют циркадный локомоторный ритм и пути выработки [8, 9]. Например, miRNA-276a и let-7 могут регулировать экспрессию пейсмекерного гена timeless [10, 11], тогда как miRNA-276b может контролировать циркадный локомоторный ритм, подавляя экспрессию Beadex [12]. Кроме того, было высказано предположение, что miRNA могут модулировать экспрессию генов в своих бактериях-мишенях и способствовать их росту, в результате формируя микробиоту кишечника [13].Таким образом, мы предполагаем, что miRNA-10a, которая ритмично экспрессируется и регулирует гены, участвующие в метаболизме липидов и глюкозы [14], может влиять на микробиоту кишечника и чувствительность к инсулину. В этом исследовании мы обнаружили, что miRNA-10a-5p облегчает вызванное HFD ожирение, непереносимость глюкозы и инсулинорезистентность. Более того, miRNA-10a-5p поддерживала суточные паттерны триглицеридов и микробиоты кишечника, которые были нарушены приемом HFD.

    2. Материалы и методы
    2.1. Животные и экспериментальный план

    Всего 126 мышей-самцов C57BL / 6J (возраст 8 недель) были приобретены у Huabukang Biotech Company (Пекин, Китай).После акклиматизации в течение 1 недели все мыши были случайным образом разделены на 3 группы (): контрольная обработка, мыши, получавшие диету с низким содержанием жиров и через желудочный зонд с физиологическим раствором; Лечение HFD, мышей, которым вводили HFD через зонд с физиологическим раствором; Обработка миРНК, мышей кормили HFD и вводили через зонд miRNA-10a-5p (100 пмоль / мышь в день). Диеты с низким содержанием жиров (10%) и высоким содержанием жиров (45%) были приобретены у Research Diets (Нью-Брансуик, Нью-Джерси, США). Миметики miRNA-10a-5p были приобретены у Guangzhou RiboBio, Co., Ltd (Гуанчжоу, Китай). Всех мышей содержали в режиме 12: 12 свет / темнота (время Цайтгебера (ZT)) в пластиковых клетках при стандартных условиях и без доступа к корму и воде.Во время эксперимента массу тела (BW) регистрировали каждые две недели. После восьми недель лечения шесть мышей в каждой группе были случайным образом умерщвлены в 6:00 (время Zeitgeber 0 [ZT0], свет включен), 10:00 (ZT4), 14:00 (ZT8), 18:00 (ZT12, гаснет), 22:00 (ZT16), 2:00 (ZT20) и 6:00 (ZT0) (). Образцы крови собирали путем орбитального кровотечения, сыворотку отделяли и поддерживали при -20 ° C. После открытия брюшной полости были собраны образцы печени и кишечного пищеварения и немедленно заморожены в жидком азоте.Протокол эксперимента был одобрен Комитетом по управлению протоколом и обзору столичного медицинского университета больницы Сюаньу, и мышей лечили в соответствии с рекомендациями по уходу за животными Столичного медицинского университета больницы Сюаньу (Пекин, Китай).

    2.2. Интраперитонеальный тест на глюкозу и толерантность к инсулину

    Внутрибрюшинный тест на глюкозу (IGTT) и тест на толерантность к инсулину (ITT) проводили после семи недель лечения. Животным внутрибрюшинно вводили 1.0 г глюкозы или 0,65 Ед инсулина на кг массы тела после шестичасового голодания. После инъекции глюкозы или инсулина кровь из хвостовой вены использовалась для измерения концентрации глюкозы через 0, 30, 60 и 120 минут с помощью глюкометра One Touch Ultra Easy.

    2.3. Анализ экспрессии генов

    Тотальную РНК экстрагировали из печени, как описано ранее [15]. кДНК синтезировали с использованием SuperScript II (Invitrogen, Шанхай, Китай). Праймеры смешивали со смесью SYBR Green PCR (Invitrogen) для амплификации Clock , Per2 и Cry1 с помощью количественного ПЦР-анализа в реальном времени.Результаты экспрессии генов рассчитывали с использованием сравнительного метода CT, нормализующего целевую мРНК до β -актина. Праймеры используются, как описано ранее [6] и перечислены в таблице 1.

    0 Часы 05 : ACCACAGCAACAGCAACAAC

    β девяносто один тысяча шестьдесят три

    А

    16 с девяносто один тысяча шестьдесят три

    Ген Последовательность праймеров 5-3

    Р: GGCTGCTGAACTGAAGGAAG
    Per2 F: TGTGCGATGATGATTCGTGA
    Р: GGTGAAGGTACGTTTGGTTTGC
    Cry1 F: CACTGGTTCCGAAAGGGACTC
    Р: CTGAAGCAAAAATCGCCACCT
    актина F: TGTCCACCTTCCAGCAGATGT
    R: AGCTCAGTAACAGTCCGCCTAGA
    F: TCAAATCMGGIGACTGGGTWGA
    R1: TCGATACCGGACATATGCCAKGAG
    R2: TCATAACCGCCCATATGCCATGAG
    F: TCCTACGGGAGGCAGCAGT
    R: GGACTACCAGGGTATCTAATCCTGTT

    2.4. Определение концентрации глюкозы, триглицерида и холестерина в сыворотке крови

    Концентрацию глюкозы анализировали с помощью коммерчески доступного набора (Nanjing Jiancheng Bioengineering Institute, Нанкин, Китай), а содержание триглицеридов (TG) и холестерина (Chol) определяли коммерчески доступные наборы (Beijing Strong Biotechnologies, Inc., Пекин, Китай).

    2,5. Профилирование микробиоты

    Образцы пищеварения толстой кишки были использованы для выделения ДНК полного генома, а амплификация была проведена с использованием специального праймера со штрих-кодом (16S V3 + V4).Библиотеки секвенирования были созданы и проанализированы, как описано ранее [16]. Операционные таксономические единицы (OTU) были выполнены для геномного прогнозирования микробных сообществ с помощью анализа Tax4Fun, как описано ранее [17].

    2.6. Определение концентраций SCFA

    После добавления деионизированной воды, предварительно охлажденной, образцы дигеста толстой кишки периодически помещали в вихревой смеситель на 2 мин. Затем образцы выдерживали при 4 ° C в течение 15 минут и центрифугировали при 5000 g в течение 15 минут при 4 ° C.Супернатант определяли путем инъекции в хроматографическую систему, как описано ранее [18].

    2.7. Количественное определение бактериального гена

    Образцы кишечного пищеварения использовали для определения количества копий гена бутирил-КоА: ацетат-КоА-трансферазы ( But ). Гены были количественно определены путем определения стандартной кривой, и праймеры использовали, как описано ранее [6] и перечислено в таблице 1.

    2.8. Статистический анализ

    Статистический анализ выполняли с использованием ANOVA с последующими множественными сравнениями с использованием анализа Бонферрони (программа SPSS 18).Для временных рядов был проведен многомерный дисперсионный анализ с помощью теста Дункана. Данные представлены как. Значение было принято на. Матрицы для коэффициентов корреляции Пирсона r были созданы в программе GraphPad Prism (7.03). Ритмичность обнаруживалась программой CircWave v1.4 (https://www.euclock.org/).

    3. Результаты
    3.1. Влияние miRNA-10a-5p на прирост массы тела, IGTT и ITT у мышей, получавших HFD

    Как показано на рисунке 1 (a), масса тела значительно увеличилась после приема HFD в течение 8 недель, в то время как введение miRNA-10a -5p предотвратил это изменение.Прирост массы тела контрольных мышей во время эксперимента был значительно ниже, чем у мышей, получавших HFD, в то время как не наблюдалось значительной разницы в массе тела между контрольными мышами и мышами, получавшими HFD, которым вводили miRNA-10a-5p (Рисунок 1 (b )). Результаты IGTT (рисунок 1 (c)) и ITT (рисунок 1 (d)) показали, что у мышей, получавших HFD, снизилась толерантность к глюкозе и чувствительность к инсулину, тогда как введение miRNA-10a-5p улучшило эти параметры у мышей, получавших HFD.

    3.2. Влияние miRNA-10a-5p на суточные ритмы гена печеночных часов и липидов сыворотки у мышей, получавших HFD

    Как показано на рисунках 2 (a) –2 (c), HFD изменил структуру циркадных часов печеночных часов Clock , Экспрессия мРНК Per2 и Cry1 , как показано в предыдущих исследованиях [6, 7]. Clock , Per2 и Cry1 Экспрессия мРНК у мышей, которым вводили miRNA-10a-5p, показывала суточные ритмы, сходные с таковыми у контрольных мышей (таблица 2). Мы обнаружили, что HFD значительно увеличивал уровни глюкозы, триглицеридов и холестерина в сыворотке мышей по сравнению с таковыми в сыворотке мышей на диете с низким содержанием жиров, в то время как не было значительного различия в этих параметрах между контрольными мышами и мышами, получавшими HFD мышам вводили miRNA-10a-5p (Рисунки 2 (d) –2 (f)).Однако уровень глюкозы в сыворотке показал ритмичность только у контрольных мышей, в то время как содержание триглицеридов в сыворотке показало ритмичность как у контрольных мышей, так и у мышей, получавших HFD, которым вводили miRNA-10a-5p (таблица 3).

    1

    NS


    Gene Группа Acrophase Mesor Амплитуда значение

    5

    9104 2,75 0,72 <0,05
    HFD NS
    miRNA 23,21 2,77

    49

    13,05 3,07 0,47 <0,05
    HFD NS
    miRNA 13,39 3.06 0,57 <0,05
    Cry1 CON 20,64 2,22 1,19 <0,01
    2,36 1,06 <0,05

    P значение

    910

    2 910

    2

    2

    2

    2

    2



    Глюкоза CON 23.10 6,04 0,22 <0,01
    HFD NS
    miRNA NS <0,05
    HFD NS
    miRNA 22,90 2,27 0,42 <0.01

    Чтобы определить, связана ли ритмичность сывороточных триглицеридов с экспрессией генов печеночных часов, мы провели корреляционный анализ Пирсона между уровнями триглицеридов и экспрессией генов циркадных часов. Наблюдалась сильная положительная корреляция между содержанием триглицеридов в сыворотке и экспрессией Clock в печени у контрольных мышей () (рис. 2 (g)). Между тем, была менее положительная корреляция между уровнями триглицеридов в сыворотке и экспрессией Clock в печени как у контрольных мышей () (Рисунок 2 (h)), так и у мышей, получавших HFD, которым вводили miRNA-10a-5p () (Рисунок 2 (i) )).

    3.3. Влияние miRNA-10a-5p на суточные ритмы кишечной микробиоты у мышей, получавших HFD

    О циркадных ритмах кишечной микробиоты и тревожных эффектах HFD сообщалось ранее [6, 19]. Наши результаты дополнительно подтвердили, что три рода микробов, Oscillospira , Ruminococcus и Lachnospiraceae , претерпевают суточные колебания (Таблица 4; Рисунки 3 (a) –3 (c)). Однако, как описано ранее [6, 7], HFD нарушает их суточные ритмы.Важно отметить, что HFD снизил численность на Lachnospiraceae в ZT0, в то время как увеличил численность на Ruminococcus во все временные точки. Введение miRNA-10a-5p поддерживало суточные ритмы вышеупомянутых микробов.

    92


    печеночные Часы экспрессия и относительная численность Lachnospiraceae как у контрольных мышей () (рис. 3 (d)), так и у мышей, получавших HFD, которым вводили miRNA-10a-5p () (рис. 3 (f)).Однако наблюдалась лишь незначительная отрицательная корреляция между экспрессией Clock в печени и относительной численностью Lachnospiraceae у мышей, получавших HFD () (Рисунок 3 (e)).

    3.4. Влияние miRNA-10a-5p на суточные ритмы содержания бутирата и экспрессию гена

    , но у мышей, получавших HFD

    Как показано на рисунке 4 (a), мы наблюдали суточные колебания бутирата в фекалиях и нарушение его суточного ритма из-за HFD. . Введение miRNA-10a-5p поддерживало суточный ритм уровня бутирата.Кроме того, введение miRNA-10a-5p восстановило суточные колебания обильной экспрессии микробного гена But , который кодирует фермент, участвующий в синтезе бутирата, после нарушения, вызванного приемом HFD (Таблица 4; Рисунок 4 (b)). .

    4. Обсуждение

    Длительное употребление HFD может привести к дисфункции метаболизма глюкозы и липидов и дисбактериозу кишечной микробиоты, способствуя развитию метаболических заболеваний. Было доказано, что сверхэкспрессия miRNA-10a ингибирует гены, участвующие в синтезе липидов и глюконеогенезе.Мы обнаружили, что пероральное введение miRNA-10a-5p предотвращало увеличение массы тела, вызванное HFD, и улучшало толерантность к глюкозе и чувствительность к инсулину у мышей. Эти результаты предполагают, что miRNA-10a-5p может иметь профилактическое действие против ожирения и диабета 2 типа. Неожиданно miRNA-10a-5p поддерживала суточные ритмы уровней триглицеридов в сыворотке и экспрессию генов печеночных часов Clock , Per2 и Cry1 , которые были нарушены приемом HFD. Более того, суточные ритмы бактерии Lachnospiraceae и ее метаболита бутирата поддерживались введением miRNA-10a-5p.Как и ожидалось, мы обнаружили, что численность Lachnospiraceae показала сильную корреляцию с экспрессией гена Clock . Основываясь на этих результатах, мы предполагаем, что miRNA-10a-5p может уменьшать HFD-индуцированную резистентность к инсулину посредством регуляции суточного ритма Lachnospiraceae и его метаболита бутирата.

    Нарушения метаболизма глюкозы и липидов, вызванные HFD, характеризуются аномально высокими уровнями глюкозы и триглицеридов в сыворотке крови.В настоящем исследовании снижение уровней глюкозы и триглицеридов могло быть результатом ингибирующего действия miRNA-10a-5p на экспрессию в печени генов, участвующих в синтезе липидов и глюконеогенезе [14]. Кроме того, мы подтвердили, что уровни глюкозы и триглицеридов в сыворотке мышей демонстрировали суточные колебания, как сообщалось в предыдущих исследованиях [7, 20], а miRNA-10a-5p восстанавливала суточный ритм триглицеридов, который был нарушен приемом HFD. Однако суточный ритм глюкозы был изменен HFD, в отличие от предыдущего исследования [7], и miRNA-10a-5p не восстанавливала суточный ритм уровня глюкозы.Мы предполагаем, что эти противоречивые результаты были из-за времени кормления HFD. Основываясь на этих результатах, мы предполагаем, что miRNA-10a-5p оказывает важное влияние на поддержание циркадных часов триглицерида и глюкозы. Эти эффекты были дополнительно подтверждены сильной положительной корреляцией между уровнями триглицеридов в сыворотке и экспрессией Clock в печени у мышей, которым вводили miRNA-10a-5p, а также у контрольных мышей.

    Предполагается, что микробы кишечника подвержены суточным колебаниям [6].Более того, на состав и функцию кишечных микробов могут влиять диетические факторы [6]. Как и ожидалось, мы обнаружили, что три рода микробов — Oscillospira , Ruminococcus и Lachnospiraceae — демонстрировали суточные ритмы. Однако их суточные колебания нарушались приемом HFD, что согласуется с результатами предыдущих исследований, показывающих, что HFD нарушает суточный характер состава кишечной микробиоты и их функций [6, 7]. MiRNA играют жизненно важную роль в процессе формирования кишечных микробов хозяином.Примечательно, что miRNA не только важны для гомеостаза микробиоты кишечника в нормальных условиях, но также обеспечивают профилактические и терапевтические преимущества у больных, поддерживая микробиоту кишечника. Поскольку miRNA-10a-5p ритмично экспрессируется и может регулировать экспрессию генов циркадного ритма, вполне разумно, что miRNA-10a-5p может влиять на суточный ритм кишечных микробов. Восстановление суточных ритмов Oscillospira , Ruminococcus и Lachnospiraceae путем введения miRNA-10a-5p мышам, получавшим HFD, подтвердило эту теорию.Более того, сильная корреляция между экспрессией Clock в печени и относительной численностью Lachnospiraceae у мышей, которым вводили miRNA-10a-5p, предполагает, что miRNA-10a-5p облегчает HFD-индуцированный дисбиоз кишечной микробиоты, стимулируя суточные ритмы. Однако механизмы, с помощью которых miRNA-10a-5p влияет на рост Oscillospira , Ruminococcus и Lachnospiraceae , не исследованы и нуждаются в выяснении в будущих исследованиях.

    Lachnospiraceae характеризуется способностью синтезировать бутират [21, 22]. Установлено, что изменение содержания бутирата в кале сопровождалось изменением количества Lachnospiraceae . О благотворном влиянии бутирата на облегчение метаболических нарушений, вызванных HFD, сообщалось широко. Добавка бутирата предотвращает ожирение, снижает инсулинорезистентность, улучшает толерантность к глюкозе и снижает накопление жира у мышей, получавших HFD [23–25].Следовательно, мы предполагаем, что miRNA-10a-5p снижает резистентность к инсулину, главным образом, за счет модуляции суточного ритма Lachnospiraceae и его метаболита бутирата. Эффекты miRNA-10a-5p на содержание бутирата были дополнительно подтверждены его эффектами на экспрессию гена But , который кодирует фермент, участвующий в продукции бутирата.

    В заключение, наши результаты показывают, что пероральное введение miRNA-10a-5p защищает от ожирения, непереносимости глюкозы и инсулинорезистентности у мышей, получавших HFD.Кроме того, miRNA-10a-5p поддерживает суточные ритмы генов печеночных часов, уровни триглицеридов в сыворотке и содержание Lachnospiraceae в кале. Более того, наблюдалась сильная положительная корреляция между экспрессией в печени гена Clock и уровнями триглицеридов в сыворотке крови и численностью Lachnospiraceae . Наряду с увеличением числа Lachnospiraceae , содержание бутирата в кале также возобновило суточный ритм после введения miRNA-10a-5p мышам, получавшим HFD.Таким образом, мы предполагаем, что miRNA-10a-5p может улучшать индуцированные HFD метаболические нарушения посредством модуляции суточного ритма Lachnospiraceae и его метаболита бутирата.

    Доступность данных

    Данные, использованные для подтверждения результатов этого исследования, включены в статью.

    Конфликт интересов

    Авторы заявили об отсутствии конфликта интересов.

    Благодарности

    Работа поддержана Национальным фондом естественных наук Китая (81801313).

    Разрушитель мифов: есть после 17:00

    Некоторые популярные книги по диетам советуют отказаться от углеводов или вообще ничего не есть после 17 или 18 часов. Это хороший совет?

    Эти диеты часто снижают общее потребление углеводов и калорий за счет отказа от определенных видов углеводов после 17:00 (например, макарон, хлеба, риса, картофеля, печенья, тортов и безалкогольных напитков). Допускаются только овощи, молочные продукты и фрукты.

    Поиск, проведенный Sanitarium в более чем 4800 научных журналах в базе данных Medline Национальной медицинской библиотеки, не нашел ни одного исследования, которое поддерживало бы теорию о том, что для похудения необходимо исключить углеводы после 17:00.Также нет органов здравоохранения, которые одобряют такой подход.

    На недавнем симпозиуме в Университете Вуллонгонга в Австралии на тему «Углеводы, жиры, белок — какая смесь оптимальная?» Джанет Франклин из Королевской больницы принца Альфреда в Сиднее объяснила, что «на практике идеальной потери веса не существует. К разным людям требуются разные подходы в зависимости от их медицинского профиля, предпочитаемого стиля питания и пищевых предпочтений, прошлого опыта и, что наиболее важно, поведенческих проблем.Большинство людей знают, какие продукты им следует и не следует есть, но с трудом применяют эти знания на практике ».

    Теоретически, отказ от некоторых углеводов после 17:00 или отказ от еды после 20:00 может снизить общее потребление энергии в течение дня. В конечном итоге это привело бы к снижению веса.

    Но на самом деле это изменение режима питания слишком ограничивает образ жизни большинства людей. После 17:00 — время общения и семейного отдыха. Это время, когда дела дня обсуждаются за едой, которая обычно содержит некоторые из углеводов, такие как хлеб, макароны, рис и картофель, запрещенные диетой «без углеводов после 17:00».

    Приобретая обработанные пищевые продукты, будьте разумным покупателем и читайте этикетки на пищевых продуктах, чтобы узнать о пищевой ценности.

    Информационные панели по питанию (НПИ) включают информацию об энергии (килоджоули), белке, углеводах (общих и сахаристых), жирах (общих и насыщенных жирах) и натрии.

    Сравните разные продукты, используя значение на 100 грамм (г), а не значения размера порции, поскольку указанный размер порции может не совпадать с фактически имеющейся порцией. На самом деле размер вашей порции может быть больше.

    Нам лучше сократить размер порций, чем не есть после 17:00 или отказаться от углеводов. Недавнее исследование показало, что уменьшение размера порции привело к снижению потребления энергии, без каких-либо изменений в отношении чувства голода.

    При выборе размера порции задайте себе следующие вопросы:

    • Сколько еды я съел сегодня — большие порции?
    • Какие продукты были съедены — были ли это продукты с высоким содержанием жиров и калорий на порцию?
    • Сколько активности я сделал сегодня?

    Если вы ели много еды большими порциями и мало двигались, то есть смысл есть меньшие порции на ночь.

    При приеме пищи сосредоточьтесь на сокращении общего количества жиров, особенно насыщенных, поскольку жиры являются самым высоким источником килоджоулей (плотности энергии) на порцию.

    Снижение потребления жиров снизит общее потребление энергии и, в конечном итоге, приведет к снижению веса. Неважно, в какое время дня употребляются жиры, поскольку жиры, употребляемые в любое время дня, будут способствовать увеличению потребления энергии.

    Еда едят не по времени суток, а по совокупности общего количества продуктов, их состава, активности в течение дня и общего состояния здоровья, которые вызывают увеличение веса.При соблюдении баланса между приемом пищи и физической активностью в течение дня масса тела остается стабильной.

    Некоторые рекомендации по здоровому питанию

    • Ешьте много овощей, бобовых и фруктов.
    • Ешьте много злаков (включая хлеб, рис, макароны и лапшу), предпочтительно цельнозерновые.
    • Включите альтернативы нежирному мясу, рыбе, птице и / или белку.
    • Включите молоко, йогурты, сыры и / или альтернативные молочные продукты — по возможности выбирайте варианты с пониженным содержанием жира.
    • Пейте много воды.

    (PDF) MicroRNA-410-5p эндокринно усиливает вызванное диетой с высоким содержанием жиров ремоделирование сердца у мышей

    www.nature.com/scientificreports/

    11

    НАУЧНЫЕ ОТЧЕТЫ | (2018) 8: 8780 | DOI: 10.1038 / s41598-018-26646-4

    Эти челночные плазмиды котрансфицировали в клетки эмбриональной почки человека HEK-293T 293A плазмидой

    AAV-DJ / 8 (Cell Biolabs Inc., Сан-Диего, Калифорния) и Плазмида pHelper (Cell Biolabs) для упаковки вирусов.

    клеток и среду собирали после того, как цитопатический эффект был очевиден. После трех циклов замораживания и

    оттаивания для высвобождения вируса клеточный дебрис удаляли центрифугированием при 3000 g × 10 мин. Супернатант, содержащий вирус

    , очищали центрифугированием в градиенте плотности CsCl с последующим диализом против физиологического раствора. Было определено титрование вируса

    и доведено до 1 × 1010 БОЕ / мл.

    Крыс, получавших обычную диету, инфицировали 5 × 108 единиц аденовируса, содержащими пустой вектор или вектор

    , экспрессирующий pre-miR-410, путем инъекции в хвостовую вену.Инъекции этих вирусных частиц повторяли дважды для

    в следующие две недели крысам, получавшим нормальный рацион. Крыс умерщвляли на 21 день после первой инъекции для сбора

    образцов сердца.

    Статистический анализ. Данные экспериментов выражены как средние значения ± стандартное отклонение трех независимых экспериментов.

    Статистические различия между двумя группами анализировали с использованием t-критерия Стьюдента. Статистически значимыми считались значения P <0,05

    .

    Ссылки

    1. Jee, S.H. et al. Индекс массы тела и частота случаев ишемической болезни сердца у мужчин и женщин Южной Кореи. Американский журнал эпидемиологии

    162, 42–48 (2005).

    2. Monji, A. et al. Активация рецептора глюкагон-липидного пептида-1 меняет процесс ремоделирования сердца за счет нормализации стеатоза сердца и окислительного стресса

    при диабете 2 типа. Американский журнал физиологии. Сердце и физиология кровообращения 305, h395–304 (2013).

    3.Leieit-Nestler, M. et al. Важность передачи сигналов лептина и преобразователя сигналов и активатора активации транскрипции-3 в

    , опосредующих гипертрофию сердца, связанную с ожирением. Журнал трансляционной медицины 11, 170 (2013).

    4. odriguez, W. E., Joshua, I. G., Falcone, J. C. и Tyagi, S. C. Пиоглитазон предотвращает ремоделирование сердца при сахарном диабете 2 типа, вызванном высоким содержанием жиров и калорий. Американский журнал физиологии. Сердце и физиология кровообращения 291, H81–87 (2006).

    5. Fernandois, D. et al. Рисспептин участвует в развитии фолликулов яичников у крыс в процессе старения. Эндокринологический журнал 228,

    161–170 (2016).

    6. Wang, H. T. et al. Влияние снижения ожирения на сохранение функции сердца и ослабление ремоделирования левого желудочка,

    окислительный стресс и воспаление у тучных мышей. Журнал трансляционной медицины 10, 145 (2012).

    7. Qin, F. et al. Полифенолы ресвератрол и S17834 предотвращают структурные и функциональные последствия вызванного диетой метаболического заболевания сердца у мышей.Тираж 125, 1757–1764, S1751-1756 (2012).

    8. Zhou, H. et al. Участие hoA / OC в фиброзе миокарда на модели диабета 2 типа на крысах. Acta Pharmacologica Sinica 32,

    999–1008 (2011).

    9. Toblli, J.E., Cao, G., Deosa, G. & Forcada, P. стимулировали кардиальную экспрессию ингибитора активатора плазминогена 1 и трансформировали

    фактора роста бета1 у тучных крыс Zucer периндоприлом. Сердце 91, 80–86 (2005).

    10. Lonn, P., Moren, A., aja, E., Dahl, M. и Moustaas, A. Регулирование стабильности рецепторов TGFbeta и Smads. Cell research 19,

    21–35 (2009).

    11. Замани, Н. и Браун, К. В. Новые роли суперсемейства трансформирующих факторов роста {бета} в регулировании ожирения и расхода энергии

    . Эндокринные обзоры 32, 387–403 (2011).

    12. Тан, С. М., Чжан, Ю., Коннелли,. А., Гилберт,. E. & elly, D. J. Целенаправленное подавление передачи сигналов активин-рецептор-лифиназа 5

    ослабляет сердечную дисфункцию после инфаркта миокарда.Американский журнал физиологии. Сердце и физиология кровообращения

    298, h2415–1425 (2010).

    13. Aubin, M.C. et al. Самки крыс, получавшие диету с высоким содержанием жиров, были связаны с сосудистой дисфункцией и сердечным фиброзом в отсутствие явного ожирения и гиперлипидемии: терапевтический потенциал ресвератрола. Журнал фармакологии и экспериментальной терапии

    325, 961–968 (2008).

    14. Бартель, Д. П. МикроНК: распознавание мишеней и регуляторные функции.Cell 136, 215–233 (2009).

    15. Кондорелли, Г., Латронико, М. В. и Дорн, Г. В. 2-е микроННК при сердечных заболеваниях: предполагаемые новые терапевтические мишени? European Hearts t

    journal 31, 649–658 (2010).

    16. Caruso, P. et al. Динамические изменения профилей микро-ДНК легких при развитии легочной гипертензии вследствие хронической гипоксии

    и монокроталина. Артериосклероз, тромбоз и сосудистая биология 30, 716–723 (2010).

    17. Ганесан, Дж.и другие. Mi-378 контролирует сердечную гипертрофию путем комбинированного подавления митоген-активируемых протеин-иназных факторов

    факторов. Тираж 127, 2013. С. 2097–2106.

    18. Менделл, Дж. Т. и Олсон, Э. Н. МикроНК в передаче сигналов стресса и заболеваниях человека. Cell 148, 1172–1187 (2012).

    19. Нагалингам,. S. et al. Дефицит специфической для кардиомиоцитов микро-ДНК-378 способствует развитию сердечного фиброза

    с участием паракринного механизма, зависимого от трансформирующего фактора роста бета (TGFbeta1).Журнал биологической химии 289,

    27199–27214 (2014).

    20. uwabara, Y. et al. MicroNA-451 усиливает липотоксичность сердечных миоцитов и гипертрофию сердца, вызванную высоким содержанием жиров, у

    мышей за счет подавления пути LB1 / AMP. Циркуляционные исследования 116, 279–288 (2015).

    21. Marchand, A. et al. mi-322 регулирует путь передачи сигналов инсулина и защищает от индуцированной метаболическим синдромом сердечной дисфункции

    у мышей.Biochimica et biophysica acta 1862, 611–621 (2016).

    22. Turbey, E. B. et al. Влияние ожирения на левый желудочек: мультиэтническое исследование атеросклероза (MESA). JACC.

    Визуализация сердечно-сосудистой системы 3, 266–274 (2010).

    23. Johansson, M. E. et al. Бактерии проникают в обычно непроницаемый слой слизи внутренней толстой кишки как на моделях мышиного колита, так и у

    пациентов с язвенным колитом. Gut 63, 281–291 (2014).

    24. Линсен, С. Э., de Wit, E., de Bruijn, E. & Cuppen, E. Экспрессия малых NA и специфичность штаммов у крыс. BMC genomics 11, 249

    (2010).

    25. Ю., X., Оденталь, М. и Фрис, Дж. У. Экзосомы как переносчики miNA: формирование-функция-будущее. Международный молекулярный журнал

    наук 17 (2016).

    26. Ноян-Ашраф, М. Х. и др. Аналог глюкагона-пептида-1 обращает вспять молекулярную патологию и сердечную дисфункцию на мышиной модели ожирения

    .Тираж 127: 74–85 (2013).

    2 7. Fang, C. X. et al. Гипертрофическая кардиомиопатия при ожирении, вызванном диетой с высоким содержанием жиров: роль подавления фактора транскрипции головы

    и транскрипции гена атрофии. Американский журнал физиологии. Сердце и физиология кровообращения 295, h2206 – h2215 (2008).

    28. Wang, A. Y. et al. Давление наполнения желудочка левого желудочка с помощью допплерэхокардиографии у пациентов с терминальной стадией почечной недостаточности. Гипертония

    52, 107–114 (2008).

    29. Xie, M. et al. Предшественники 5′-кэпированных микроНК млекопитающих, которые генерируют единственную микроНК. Cell 155, 1568–1580 (2013).

    30. Clar, A. L. & Naya, F. J. МикроNAs в Gtl2-Dio3 некодирующем NA-локусе, регулируемом фактором 2 энхансера миоцитов (MEF2)

    , способствуют пролиферации кардиомиоцитов путем нацеливания на указанный транскрипционный коактиватор2. Журнал биологической химии 290

    (2015).

    Содержимое предоставлено Springer Nature, применяются условия использования.Права защищены

    5П-1.001. Определения, 5П-1. Программы общественного питания, 5P. Отдел продовольствия, питания и благополучия, 5. Министерство сельского хозяйства и бытовых услуг, Административный кодекс Флориды

    1 Для целей данной главы используются определения в разделах 11595.402, FS, 13 и 157 CFR 210.2, 187 CFR 215.2, 217 CFR 220.2 , 247 CFR 225.2, 277 CFR 245.2, 307 CFR 247.1, 337 CFR 248.2, 367 CFR 250.2, 397 CFR 251.3, 427 CFR 252.2, 45 все пересмотрены с 1 января 2018 г. : // www.flrules.org/Gateway/reference.asp?No=Ref-09512, 65 и применяется следующее:

    70 (1) «Программы школьного питания» означают Национальную программу школьных обедов, Программу школьных завтраков, Программу закусок после школы и Программу свежих фруктов и овощей.

    92 (2) «Летние программы питания» означают программу летнего питания и вариант «Летнее питание».

    107 (3) «Программы детского питания» означают все программы, включенные в программы школьного питания и летние программы питания.

    123 (4) «Программы распределения продуктов питания» означают Программу пищевых добавок для детей, Программу питания детей Министерства сельского хозяйства США, Программу обработки пищевых продуктов Министерства сельского хозяйства США, Программу чрезвычайной продовольственной помощи и Программу Министерства обороны по свежим фруктам и овощам.

    157 (5) «Административная проверка» означает 162 оценку вне офиса и на месте каждого спонсора, участвующего в программах детского питания.

    174 (6) «Альтернативный пункт обслуживания» означает подсчет приема пищи в любом месте, кроме пункта обслуживания, например, в начале линии обслуживания.

    198 (7) «Данные за апрель» означает информацию, ежегодно представляемую Спонсором в департамент, включая общее количество зачисленных детей и процент детей, прошедших прямую сертификацию по состоянию на первый день апреля.

    232 (8) «Программа питания детей Министерства сельского хозяйства США» означает программу, которая координирует распределение продуктов питания Министерства сельского хозяйства США среди спонсоров, участвующих в программах школьного питания и программах летнего питания.

    260 (9) «Требование о возмещении» означает требование, ежемесячно направляемое в департамент Спонсором на возмещение расходов на питание в рамках программ детского питания.

    284 (10) «Программа дополнительных продуктов питания» означает программу, которая координирует распределение продуктов питания Министерства сельского хозяйства США среди имеющих право на доход пожилых людей в возрасте не менее 60 лет.

    309 (11) «Подрядчик» означает коммерческое предприятие, государственную или некоммерческую частную организацию или физическое лицо, которое заключает договор со Спонсором на предоставление товаров или услуг для Программ детского питания.

    340 (12) «План корректирующих действий» означает письменный план, разработанный спонсором или агентством-получателем при содействии и с согласия департамента, для определения действий, которые необходимо предпринять для исправления недостатков программы, выявленных в рамках административной проверки спонсора. Обзор сайта, посещение сайта или посещение технической помощи.

    389 (13) «Департамент» означает Департамент сельского хозяйства и бытового обслуживания.

    399 (14) «Программа Министерства обороны по свежим фруктам и овощам» означает программу, которая позволяет спонсорам перенаправлять финансовые выплаты от USDA Foods на свежие продукты, закупаемые Министерством обороны.

    430 (15) «Прямая сертификация» или «Прямая сертификация» означает процесс, с помощью которого ребенок устанавливает право на бесплатное школьное питание на основе информации, полученной непосредственно от других государственных органов, местных агентств или уполномоченных представителей, подтверждающих, что ребенок является участником. домохозяйства, получающего помощь по программе SNAP; является членом семьи, получающей помощь по программе TANF; или приемный ребенок, бездомный ребенок, ребенок-мигрант, ребенок Head Start или ребенок-беглец.

    508 (16) «Фермерский рынок» означает фиксированное место, где два или более фермеров продают свою сельскохозяйственную продукцию непосредственно населению, включая фрукты и овощи, мясо, рыбу, птицу, молочные продукты и зерно.

    542 (17) «Программа питания на фермерском рынке» означает программу, связанную со Специальной программой дополнительного питания для женщин, младенцев и детей (WIC), которая обеспечивает участников WIC свежими фруктами и овощами и направлена ​​на повышение осведомленности, использование и продажи на фермерских рынках.

    586 (18) «Служба питания и питания (FNS)» означает федеральное агентство в составе Министерства сельского хозяйства США (USDA), ответственное за управление программами детского питания на национальном уровне.

    614 (19) «Приемный ребенок» означает ребенка, официально помещенного судом или Департаментом по делам детей и семей Флориды в приемную семью, как это определено в Разделе 64239.01 (29), F.S. 644 Это не включает ребенка, находящегося в неофициальном соглашении или под постоянной опекой, которые могут существовать вне государственных или судебных систем.

    668 (20) «Ребенок Head Start» означает ребенка, зарегистрированного в качестве участника программы Federal Head Start или любой финансируемой государством программы дошкольного образования, в которой используются критерии соответствия, идентичные или более строгие, чем Federal Head Start.

    704 (21) «Бездомный ребенок» означает ребенка, который определен местным агентством по связям с общественностью или сотрудником приюта для бездомных как не имеющий постоянного, обычного и адекватного ночлега.

    737 (22) «Существенная неудача» означает, что либо спонсор несколько раз игнорировал требования Программы детского питания, либо не исправлял нарушения требований Программы детского питания.

    764 (23) «Ребенок-мигрант» означает ребенка, зарегистрированного в Программе образования для мигрантов, как это определено штатом или местным координатором программы обучения для мигрантов.

    787 (24) «Чистые денежные ресурсы» означают все денежные средства, которые доступны или были начислены на счет некоммерческого школьного питания в любой момент времени, за вычетом денежных средств к оплате. Такие денежные средства могут включать денежные средства в кассе, денежные средства к получению, прибыль от инвестиций, денежные средства на депозите и стоимость акций, облигаций или других оборотных ценных бумаг.

    840 (25) «Счет некоммерческой службы школьного питания» означает счет, на котором хранятся все доходы от всех операций по организации питания, проводимых Спонсором, и вся прибыль используется исключительно для работы или улучшения таких служб питания.

    879 (26) «Данные за октябрь» означают данные, ежегодно представляемые Спонсором в департамент, включая общее количество зачисленных детей и количество детей, имеющих право на бесплатное питание или питание по сниженной цене у каждого Спонсора по состоянию на последний день работы в октябре. .

    923 (27) «Пункт обслуживания» означает тот пункт в сфере общественного питания, где можно точно определить, что возмещаемое бесплатное питание, питание по сниженной цене или платное питание было подано соответствующему критериям ребенку.

    958 (28) «Предполагаемый спонсор» означает организацию, подающую заявку на роль спонсора одной или нескольких программ детского питания.

    976 (29) «Агентство-получатель» означает агентство или организацию, которые получают продукты питания USDA для распределения среди правомочных лиц или для использования в обедах, предоставляемых правомочным лицам, в соответствии с соглашениями с агентством-распределителем или субдистрибьюторами, как определено в 10157 CFR 250 .2, 1018 или с другим агентством-получателем.

    1023 (30) «Сбежавший ребенок» означает ребенка, который был определен сотрудником местного агентства образования как сбежавший из дома и получающий помощь в рамках программы в соответствии с Законом о сбежавшей и бездомной молодежи.

    1052 (31) «Безупречный летний вариант» означает некоммерческую программу общественного питания, которая предоставляет детям школьного возраста доступ к бесплатному питанию, когда школа не работает, и управляется Спонсором, который также реализует Национальную программу школьных обедов.

    1090 (32) «Период обслуживания» означает время, указанное Спонсором для подачи завтрака, обеда или закусок.

    1108 (33) «Проверка объекта» означает проверку объекта общественного питания, проводимую департаментом для обеспечения соблюдения соответствующих Федеральных правил, законодательных актов Флориды и Административного кодекса Флориды, касающихся работы программ детского питания.

    1144 (34) «Посещение объекта» означает проверку объекта общественного питания, проводимую Спонсором для обеспечения соблюдения соответствующих Федеральных постановлений, Статутов Флориды и Административного кодекса Флориды, касающихся работы Программ детского питания.

    1180 (35) «SNAP» означает Программу дополнительной помощи в области питания, учрежденную в соответствии с Законом о пищевых продуктах и ​​питании от 2008 г. (11987 U.S.C. 2011 1201et seq.).

    1203 (36) «Спонсор» означает любую организацию, которая проводит программу в соответствии с действующим соглашением с департаментом.

    1220 (37) «Последовательные соглашения о закупках», обычно называемые «дополнительными соглашениями», означают соглашения, заключенные с Подрядчиками одним Спонсором, позволяющие другому Спонсору совершать закупки по указанным ценам или ниже на тех же условиях и на тех же условиях. контрактов, заключенных с другими Спонсорами, и когда такие покупки обходятся Спонсору по более низкой цене.

    1279 (38) «Летняя программа общественного питания» означает некоммерческую программу общественного питания, осуществляемую правомочным Спонсором для предоставления детям школьного возраста доступа к бесплатному питанию, когда школа не работает.

    1309 (39) «TANF» означает программу временной помощи нуждающимся семьям в соответствии с частью A раздела IV Закона о социальном обеспечении (133142 U.S.C.621 1334et seq.).

    1336 (40) «Программа экстренной продовольственной помощи» означает программу, которая дополняет рацион лиц, имеющих право на получение дохода, путем предоставления продуктов питания USDA через агентства-получатели.

    1359 (41) «USDA» означает Министерство сельского хозяйства США.

    1368 (42) «Продукты питания Министерства сельского хозяйства США» означают продукты питания, пожертвованные или доступные для пожертвования Министерством сельского хозяйства США в рамках программ распределения продуктов питания1386.

    1387 (43) «Программа переработки пищевых продуктов Министерства сельского хозяйства США» означает программу, которая позволяет преобразовывать сыпучие продукты Министерства сельского хозяйства США в готовый конечный продукт.

    1410 (44) «Подтверждение» означает подтверждение права на получение бесплатных льгот или льгот по сниженной цене в рамках программ школьного питания.

    1427 Регулирующий орган 1429570.07 (23), 1430595.404 (4), 1431 (10), (11) FS. Закон введен в действие 1436595,402, 1437595,404 ФС. 1439История — новый 4-19-73, перепрошитый 12-5-74, ранее 6A-7.40, исправленный 5-3-88, бывший 14486A-7.040, 1449 исправленный 6-21-18, 12-16-18.

    Материнская высокобелковая диета программирует нарушение костной массы потомства посредством miR-24-1-5p-опосредованного нацеливания SMAD5 в остеобласты

  • 1.

    Cooper C et al (1997) Рост в младенчестве и костная масса в более позднем возрасте.Ann Rheum Dis 56 (1): 17–21

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 2.

    Cooper C et al (2002) Фетальные причины остеопоротических переломов. Calcif Tissue Int 70 (5): 391–394

    CAS
    PubMed

    Google Scholar

  • 3.

    Джордан К.М., Купер С. (2002) Эпидемиология остеопороза. Передовая практика Res Clin Rheumatol 16 (5): 795–806

    CAS
    PubMed

    Google Scholar

  • 4.

    Thompson JN (2007) Питание плода и гипертония у взрослых, диабет, ожирение и ишемическая болезнь сердца. Neonatal Netw 26 (4): 235–240

    PubMed

    Google Scholar

  • 5.

    Cleal JK et al (2007) Несоответствующее питание до и после родов приводит к дисфункции сердечно-сосудистой системы и изменению функции почек в зрелом возрасте. Proc Natl Acad Sci USA 104 (22): 9529–9533

    CAS
    PubMed

    Google Scholar

  • 6.

    Stocker CJ, Arch JR, Cawthorne MA (2005) Фетальное происхождение инсулинорезистентности и ожирения. Proc Nutr Soc 64 (2): 143–151

    CAS
    PubMed

    Google Scholar

  • 7.

    Симмонс Р. (2011) Эпигенетика и материнское питание: природа против воспитания. Proc Nutr Soc 70 (1): 73–81

    CAS
    PubMed

    Google Scholar

  • 8.

    Goyal D, Limesand SW, Goyal R (2019) Эпигенетические реакции и происхождение здоровья и болезней в процессе развития.J Endocrinol 242 (1): T105 – T119

    CAS
    PubMed

    Google Scholar

  • 9.

    Baird J et al (2011) Предсказывает ли масса тела при рождении костную массу во взрослом возрасте? Систематический обзор и метаанализ. Osteoporos Int 22 (5): 1323–1334

    CAS
    PubMed

    Google Scholar

  • 10.

    Flanagan DE et al (1999) Снижение роста плода и секреция гормона роста во взрослой жизни. Clin Endocrinol 50 (6): 735–740

    CAS

    Google Scholar

  • 11.

    Javaid MK et al (2006) Статус витамина D у матери во время беременности и масса костной ткани в детстве в возрасте 9 лет: продольное исследование. Ланцет 367 (9504): 36–43

    CAS
    PubMed

    Google Scholar

  • 12.

    Zhu K et al (2014) Статус витамина D у матери во время беременности и костная масса у потомства в возрасте 20 лет: проспективное когортное исследование. J Bone Miner Res 29 (5): 1088–1095

    CAS
    PubMed

    Google Scholar

  • 13.

    Ганпуле А. и др. (2006) Связь костной массы у индийских детей с питанием матери и диетой во время беременности: исследование материнского питания в Пуне. J Clin Endocrinol Metab 91 (8): 2994–3001

    CAS
    PubMed

    Google Scholar

  • 14.

    Villa CR et al (2016) Материнский витамин D благотворно влияет на метаболизм, здоровье кишечника и костей потомства самцов мышей в условиях ожирения. Int J Obes 40 (12): 1875–1883 ​​

    CAS

    Google Scholar

  • 15.

    Suntornsaratoon P, Krishnamra N, Charoenphandhu N (2015) Положительные долгосрочные результаты от предположения о добавлении кальция кормящим крысам и их потомству. Am J Physiol Endocrinol Metab 308 (11): E1010 – E1022

    CAS
    PubMed

    Google Scholar

  • 16.

    Hastings-Roberts MM, Zeman FJ (1977) Влияние белковой недостаточности, парного вскармливания или диетических добавок на рост матери, плода и плаценты у крыс. J Nutr 107 (6): 973–982

    CAS
    PubMed

    Google Scholar

  • 17.

    Mehta G et al (2002) Внутриутробное воздействие материнской диеты с низким содержанием белка снижает массу взрослой кости и изменяет морфологию пластинки роста у крыс. Calcif Tissue Int 71 (6): 493–498

    CAS
    PubMed

    Google Scholar

  • 18.

    Андреасян К. и др. (2007) Более высокое потребление белка матерью на поздних сроках беременности связано с более низким индексом массы тела ребенка при рождении. Eur J Clin Nutr 61 (4): 498–508

    CAS
    PubMed

    Google Scholar

  • 19.

    Blumfield ML et al (2012) Систематический обзор и метаанализ потребления энергии и макроэлементов во время беременности в развитых странах. Nutr Rev 70 (6): 322–336

    PubMed

    Google Scholar

  • 20.

    Rush D, Stein Z, Susser M (1980) Рандомизированное контролируемое испытание пренатальных пищевых добавок в Нью-Йорке. Педиатрия 65 (4): 683–697

    CAS
    PubMed

    Google Scholar

  • 21.

    Ota E et al (2012) Дородовые диетические рекомендации и добавки для увеличения потребления энергии и белка. Кокрановская база данных Syst Rev 9: CD000032

    Google Scholar

  • 22.

    Sloan NL et al (2001) Влияние пренатального потребления белка с пищей на массу тела при рождении. Nutr Res 21 (1-2): 129–139

    CAS

    Google Scholar

  • 23.

    Rigueur D, Lyons KM (2014) Окрашивание всего скелета.Методы Mol Biol 1130: 113–121

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 24.

    Али С.Дж. и др. (2019) Потеря костной массы в модели болезни Паркинсона у мышей МРТР вызывается снижением остеобластогенеза и усилением остеокластогенеза. Toxicol Appl Pharmacol 363: 154–163

    CAS
    PubMed

    Google Scholar

  • 25.

    Sharan K et al (2017) Регулирование костной массы посредством пути рецептора мелатонина-MT2, производного от эпифиза.J Pineal Res 63 (2): e12423

    PubMed Central

    Google Scholar

  • 26.

    Ali SJ et al (2019) Воздействие хлорпирифоса вызывает симптомы паркинсонизма и связанную с этим потерю костной массы у взрослых швейцарских мышей-альбиносов. Neurotox Res 36 (4): 700–711

    CAS
    PubMed

    Google Scholar

  • 27.

    Roman-Garcia P et al (2014) Витамин B (1) (2) -зависимый синтез таурина регулирует рост и костную массу.J Clin Invest 124 (7): 2988–3002

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 28.

    Lewis KE et al (2017) Скелетные сайт-специфические изменения костной массы в генетической мышиной модели дупликации 15q11-13 человека, наблюдаемой при аутизме. Научный доклад 7 (1): 9902

    PubMed
    PubMed Central

    Google Scholar

  • 29.

    Sharan K et al (2011) Новый аналог кверцетина из лекарственного растения способствует достижению максимальной костной массы и заживлению кости после травмы, а также оказывает анаболический эффект на остеопоротическую кость: роль арилуглеводородного рецептора как медиатора остеогенное действие.J Bone Miner Res 26 (9): 2096–2111

    CAS
    PubMed

    Google Scholar

  • 30.

    Bachagol D et al (2018) Стимуляция экспрессии IGF-1 в печени способствует достижению максимальной костной массы у растущих крыс: исследование с маслом косточек граната. J Nutr Biochem 52: 18–26

    CAS
    PubMed

    Google Scholar

  • 31.

    Пахва Х., Хан М.Т., Шаран К. (2020) Гипергликемия нарушает миграцию клеток остеобластов и хемотаксис из-за снижения митохондриального биогенеза.Mol Cell Biochem 469: 109–118

    CAS
    PubMed

    Google Scholar

  • 32.

    Gavva C et al (2020) Гликозаминогликаны из отходов переработки пресноводной рыбы — выделение, структурная характеристика и остеогенная активность. Int J Biol Macromol 145: 558–567

    CAS
    PubMed

    Google Scholar

  • 33.

    Khan K et al (2012) [6] -Гингерол вызывает потерю костной массы у интактных взрослых мышей и усиливает функцию остеокластов через ваниллоидный 1 канал временного рецепторного потенциала.Mol Nutr Food Res 56 (12): 1860–1873

    CAS
    PubMed

    Google Scholar

  • 34.

    Kureel J et al (2014) miR-542-3p подавляет пролиферацию и дифференцировку клеток остеобластов, нацелен на передачу сигналов BMP-7 и ингибирует образование кости. Смерть клетки 5: e1050

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 35.

    Kushwaha P et al (2016) MicroRNA 874-3p эпигенетически оказывает анаболическое действие на скелет во время отъема, подавляя экспрессию Hdac1.J Biol Chem 291 (8): 3959–3966

    CAS
    PubMed

    Google Scholar

  • 36.

    Hyde NK et al (2017) Питание матери во время беременности: потребление питательных веществ, важных для здоровья костей. Matern Child Health J 21 (4): 845–851

    PubMed

    Google Scholar

  • 37.

    Switkowski KM et al (2016) Потребление материнского белка во время беременности и линейный рост потомства.Am J Clin Nutr 104 (4): 1128–1136

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 38.

    Walther T et al (2011) Высокобелковая диета в период лактации приводит к внезапной детской смерти у мышей. PLoS ONE 6 (3): e17443

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 39.

    Dirckx N, Van Hul M, Maes C (2013) Рекрутирование остеобластов в места формирования кости при развитии скелета, гомеостазе и регенерации.Врожденные дефекты Res C Embryo Today 99 (3): 170–191

    CAS
    PubMed

    Google Scholar

  • 40.

    Karner CM, Long F (2018) Метаболизм глюкозы в костях. Кость 115: 2–7

    CAS
    PubMed

    Google Scholar

  • 41.

    Maredsous C et al (2016) Экспозиция с высоким содержанием белка во время беременности или кормления грудью или после отлучения от груди имеет характерную для периода подпись в отношении веса детенышей крысы, ожирения, потребления пищи и гомеостаза глюкозы до 6-недельного возраста.J Nutr 146 (1): 21–29

    Google Scholar

  • 42.

    Carlin G et al (2020) Перинатальное воздействие на крыс материнской диеты с различным количеством и качеством белка влияет на риск избыточной массы тела у взрослых самок потомства. J Nutr Biochem 79: 108333

    CAS
    PubMed

    Google Scholar

  • 43.

    Carlin G et al (2019) Высокобелковая диета матери во время беременности изменяет массу тела потомства крыс и передачу сигналов инсулина, но не предпочтение макроэлементов во взрослом возрасте.Питательные вещества 11 (1): 96

    CAS
    PubMed Central

    Google Scholar

  • 44.

    Kenkre JS, Bassett J (2018) Цикл ремоделирования кости. Ann Clin Biochem 55 (3): 308–327

    CAS
    PubMed

    Google Scholar

  • 45.

    Танака С. (2007) Сигнальная ось в биологии остеокластов и терапевтическое нацеливание в системе RANKL / RANK / OPG. Am J Nephrol 27 (5): 466–478

    PubMed

    Google Scholar

  • 46.

    Jensen ED, Gopalakrishnan R, Westendorf JJ (2010) Регулирование экспрессии генов в остеобластах. BioFactors 36 (1): 25–32

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 47.

    Деодати А., Индзаги Е., Чианфарани С. (2019) Эпигенетика и внутриутробная предрасположенность к метаболическим заболеваниям. Передний Genet 10: 1270

    CAS
    PubMed

    Google Scholar

  • 48.

    Gicquel C, El-Osta A, Le Bouc Y (2008) Эпигенетическая регуляция и программирование плода. Лучшая практика Res Clin Endocrinol Metab 22 (1): 1–16

    CAS
    PubMed

    Google Scholar

  • 49.

    Dumortier O et al (2014) Ограничение материнского белка приводит к панкреатической недостаточности у потомства: роль мисэкспрессированной микроРНК-375. Диабет 63 (10): 3416–3427

    CAS
    PubMed

    Google Scholar

  • 50.

    Alejandro EU et al (2014) МикроРНК и mTOR, индуцированные материнской диетой, лежат в основе дисфункции бета-клеток у потомства. J Clin Invest 124 (10): 4395–4410

    PubMed
    PubMed Central

    Google Scholar

  • 51.

    Zhang J et al (2009) Высокожировая диета матери во время беременности и кормления грудью изменяет экспрессию в печени инсулиноподобного фактора роста-2 и ключевых микроРНК у взрослых потомков. BMC Genomics 10: 478

    PubMed
    PubMed Central

    Google Scholar

  • 52.

    Wang RN et al (2014) Передача сигналов костного морфогенетического белка (BMP) при развитии и заболеваниях человека. Genes Dis 1 (1): 87–105

    PubMed
    PubMed Central

    Google Scholar

  • 53.

    Lee KS et al (2000) Runx2 является общей мишенью для трансформирующего фактора роста бета1 и костного морфогенетического белка 2, а сотрудничество между Runx2 и Smad5 индуцирует экспрессию специфичных для остеобластов генов в линии плюрипотентных мезенхимальных клеток-предшественников C2C12.Mol Cell Biol 20 (23): 8783–8792

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 54.

    Karner CM, Lee SY, Long F (2017) Bmp индуцирует дифференцировку остеобластов посредством передачи сигналов как Smad4, так и mTORC1. Mol Cell Biol 37 (4): e00253-16

    PubMed.
    PubMed Central

    Google Scholar

  • 55.

    Nishimura R et al (1998) Smad5 и DPC4 являются ключевыми молекулами, опосредующими BMP-2-индуцированную дифференцировку остеобластов плюрипотентной мезенхимальной линии клеток-предшественников C2C12.J Biol Chem 273 (4): 1872–1879

    CAS
    PubMed

    Google Scholar

  • 56.

    Yamamoto N et al (1997) Smad1 и smad5 действуют ниже внутриклеточных сигналов BMP-2, которые ингибируют миогенную дифференцировку и индуцируют дифференцировку остеобластов в миобластах C2C12. Biochem Biophys Res Commun 238 (2): 574–580

    CAS
    PubMed

    Google Scholar

  • .

    Добавить комментарий

    Ваш адрес email не будет опубликован.

    © Женский журнал 2022 Все права закотяшены

    Элемент Группа Acrophase Мезор Амплитуда

    4 9104 9104 9104 9104

    0,021 0,008 <0,05
    HFD NS
    miRNA 5,72 0,021 0,021 0,011 0,011 5,33 0,005 0,002 <0,05
    HFD NS
    miRNA 4.48 0,005 0,002 <0,05
    Lachnospiraceae CON 23,95 0,040 0,004 9104 9104 23,97 0,041 0,002 <0,05
    Бутират CON 23,73 99,00 6.35 <0,05
    HFD NS
    miRNA 23,94 102,71 1,15 9104 <0,05
    Но HFD NS
    miRNA NS
    10
    10